On thursday, Dec. 28, Jim showed me a short movie clip from Nat. Geographic about poachers and poacher patrol and found out some startling information about the Poacher Patrol.
The clip shows the group of poacher patrollers (goodguys, right?) in South America, as they look for signs of poachers that cut down the trees. The Patrol does not want the trees to be cut down because the rain will begin to wash away the soil in the places where the trees have been taken. Eventually they hear the sound of a distant chainsaw and begin to creep up on the wicked people who cut down poor defenseless trees. Moving when the chainsaw is running (or so they think) in order to cover the sound of thier approach, the patrol finally falls upon a group of local farmers and promptly slaps hand cuffs on every one of them. One officer then hands one of them a GPS Navigator and explains to him that it is a lie detector (a lie, ironically). The farming tree poacher then has to answer the officers questions regarding the location of his rebel lumber yard and such. The heroic poacher patrollers also find out that the farmers are using the wood to build some much needed..., I think it had something to do with the storage of crops or something that the farmers really needed.
Once at the secret lumber yard, wich is filled with beautiful South American lumber, the heroic patrollers proceed to torch every square inch of lumber that they can find in the name of preserving the environment.
Does this make any sense at all?? That leaves another spot of barren land to get washed away by the rain, it also makes it so that the farmers (not poachers, that's just dumb) have to cut down more trees somewhere else and, these biologists (that's what some of these patrollers were) aren't doing much to curb "global warming" now, are they? I think they were just being jerks.
It makes me think differently about poachers. Poor, helpless poachers.
Sunday, December 31, 2006
Monday, December 18, 2006
High Speed Chase on 104
On Friday Dec. 15, 2006, at approximately 4:15 pm. I was at work cooking haddock when a NYS Police Trooper pulled in the parking lot. Of course this wasn't very unusual by itself, however, Mr Trooper stepped out of his patrol car and began talking with a man in a white sedan, which was slightly more unusaul. Soon I was distracted from being distracted by the police officer, and began to focus on cooking food (a good thing I suppose). About 1 minute later Brianna came rushing in from the dining room screaming something about a car hitting a tree. I looked up and saw that the white sedan and the police car wre gone and in place of them were tire tracks leading from the parking lot and into the lawn and over a small tree. The tracks continued over the lawn and then disappeared onto 104. I knew then that there was a high speed chase underway that would most likely end in an accident. About every three minutes a police vehicle would go flying by the restaurant eastward after the vehicle. I later learned that the chase had ended about 2-3 miles from orbakers right near Reed Eye Center in sodus. From what I could gather the white car had sideswiped a couple other vehicles before flying over the edge of the road and over some nasty bumps. Joel informed me today that he learned from the Wayne County Times that the car had been stolen in webster. I still haven't been able to find any articles about it on the internet site.
THE END
THE END
Tuesday, December 05, 2006
ranting
Okay, I really don't have anything to say. I am only doing this so that my blog won't die. Please don't die blog, don't die on me, I love you! Stay with me blog come on, stay awake. No, don't go to sleep, that could be bad. You might never wake up.
This is what I mean by ranting.
Well, it looks as if the librarians are turning all the computers off. Time to go. |
Saturday, November 18, 2006
Any good ideas?
Hello everyone! This is a new post, isn't it exciting? I canever think of anything cool to write about. I need some inspiration. Or do you just write about how you stub your toe or bite your tongue?
Okay, so yesterday I made $37.50 in tips for delivering pizzas! Isn't that great? Oh yeah, I am getting pretty tired of my jobs. I want to do something else now. Any good ideas?
Okay, so yesterday I made $37.50 in tips for delivering pizzas! Isn't that great? Oh yeah, I am getting pretty tired of my jobs. I want to do something else now. Any good ideas?
Thursday, November 09, 2006
no thing
Nothing truly postworthy has happened to me in the past few days. Nothing that I can think of anyway.
By the way, those letters in the title of that other post were all command keys (I think that's what they are called).
By the way, those letters in the title of that other post were all command keys (I think that's what they are called).
Thursday, October 19, 2006
yuiopasfzxcvbn
ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da
ah-da-poo-bu-da!
I did that because I forgot what to write about.
Today at work, I got yelled at for someone elses laziness in front of everyone. I hate it when that happens.
Trivia: What do all the letters in the title have in common (aside from them all being lowercase)?
ah-da-poo-bu-da!
I did that because I forgot what to write about.
Today at work, I got yelled at for someone elses laziness in front of everyone. I hate it when that happens.
Trivia: What do all the letters in the title have in common (aside from them all being lowercase)?
Wednesday, October 11, 2006
Parts Search
My Chevy S10 LS 4x2 Pickup truck is evidently a pretty hard truck to buy parts for. All I needed for it was a bumper bar with the impact stip, and a slotted or barred grille. So far I have been to Ontario Truck Parts, the Cobbs lot in Sodus, Wilberts GM Parts in Penfield, Andy's Auto Parts in Union Hill, and the Door Store in Ontario and none of them have what I need!
Item 1, 1998 Chevy S10 LS 2WD Pickup chrome front bumper with impact strip. ($200.oo new) Item 2, 1998 Chevy S10 LS 2WD Pickup slotted/barred grille. ($125.oo new)
I almost feel as if I'm trying to get parts for a Ferarri or something.
My last stop was the Door Store and they gave me the most hope of finally getting what I need by offering to order the parts used. $140.oo for the front bumper assembly and $88.oo for the grille. I believe I will take that offer.
I do feel pretty privileged about owning such a unique piece of machinery. The LS is the second most desireable S10 pickup with the S10 extreme coming in first. My truck also has the extremely rare and super-stylish limited edition black rims. haha.
sometimes I have trouble organizing my paragraphs.
Item 1, 1998 Chevy S10 LS 2WD Pickup chrome front bumper with impact strip. ($200.oo new) Item 2, 1998 Chevy S10 LS 2WD Pickup slotted/barred grille. ($125.oo new)
I almost feel as if I'm trying to get parts for a Ferarri or something.
My last stop was the Door Store and they gave me the most hope of finally getting what I need by offering to order the parts used. $140.oo for the front bumper assembly and $88.oo for the grille. I believe I will take that offer.
I do feel pretty privileged about owning such a unique piece of machinery. The LS is the second most desireable S10 pickup with the S10 extreme coming in first. My truck also has the extremely rare and super-stylish limited edition black rims. haha.
sometimes I have trouble organizing my paragraphs.
Monday, October 09, 2006
AAAAAHHHAHAAHAHAAAHAH!!!
I am completely out of blogging ideas. My blog is dying. What shall I do to saveth it?
Joe's high. Says Ben the Bold. I wisheth I knew how to posteth a video.
I beggeth every body to helpeth me to resurecteth my blog, before it's too late.
Joe's high. Says Ben the Bold. I wisheth I knew how to posteth a video.
I beggeth every body to helpeth me to resurecteth my blog, before it's too late.
Thursday, September 21, 2006
A Story
One day, a very geeky, dorky, nerdy kid named Joe delivered a pizza to somebody's humble abode. He knocked on the door and a strange old man answered from somewhere inside. His voice was very raspy and nearly indiscernable but Joe could barely make out the words "Come on in but don't step on the rug, it's been rigged."
What happens next?? You decide. Continue my story.
What happens next?? You decide. Continue my story.
Monday, September 18, 2006
blah
Oh boy, another post.
I am at the library right now and I can't think of anything exciting to say.
I am at the library right now and I can't think of anything exciting to say.
Tuesday, September 12, 2006
SMART!!!!!!!!!!!!!!
Blog blog blog blog blog.
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
Sunday, August 27, 2006
Sunday, August 20, 2006
Free Post.
NEW POST!!!!!!!!!!!! Free Downloads.Free Viruses. Free spyware. free adware. Free smileys. Free games. (Popcap.com) Free Plasma TV. Free X-Box 360. Free screensavers. Free music on iTunes.com. Free bit-torrents. Free Ferrari F-50 with your purchase of any one of our great tasting soft drinks. Free DVD's. Free PDP's. Free PDVDP's. Free Superpowers, inquire within. Free vacation in the bahamas. Free dinner for two at Appledee's. Free movie tickets. Free police cruiser. Free assault weapons. Free ocean. Free ocean liner. Free dinosaur.
Friday, August 04, 2006
Key Words
Blogging again. Yes, remember that anyone can comment on my blog if they so desire.
My dear brother Jimmy said that in order to get more hits on my blog, I need to post more key-words. So I'll try it.
Ahem, Fall-out Boy. System of the Down. War of the Worlds. George W. Bush. Muhammed Ali. MIAI Abrams. Madison Square Garden. Ferrari. Groundhog Day. Ben Affleck. Stratacaster. McDonalds. Cigar Boats. Mechwarrior 2. Dell. Sasha Cohen. Sleeper Cell. Atom Bomb (yikes). Nascar. WWF. WWII. WWW. WWE. Perry's Ice Cream. Kermit the Frog. Cheeseburger. The Depesche Mode. I don't know if that's even spelled right.
That should do it!
My dear brother Jimmy said that in order to get more hits on my blog, I need to post more key-words. So I'll try it.
Ahem, Fall-out Boy. System of the Down. War of the Worlds. George W. Bush. Muhammed Ali. MIAI Abrams. Madison Square Garden. Ferrari. Groundhog Day. Ben Affleck. Stratacaster. McDonalds. Cigar Boats. Mechwarrior 2. Dell. Sasha Cohen. Sleeper Cell. Atom Bomb (yikes). Nascar. WWF. WWII. WWW. WWE. Perry's Ice Cream. Kermit the Frog. Cheeseburger. The Depesche Mode. I don't know if that's even spelled right.
That should do it!
Sunday, July 30, 2006
lost quarters
anewpostisinthemaking! Just letting everyone know that I am still alive. new posts upon this blog will fewen out from now on because I am lo nonger within easy ax-ess of a comp you ter. I do feel bad for all my zillions of devoted fans that are constantly checking my blog to see if I have posted anything that will awe and inspire millions of people worldwide. Very sorry.
Friday, July 14, 2006
groovy post
I made another new blog awhile ago. It is specifically designed for smarty pantses. Just click on the "Go Here" link on my sidebar.
Wednesday, July 12, 2006
Distressing News
I have most distressing news for everyone to hear; I have died.
Actually, I will be moving out of my lovely abode to live with my evil, wicked, dastardly, sinister, heartless, cruel, brother Dave. Here is the distressing part though; his new rented house is right next door to the Millimans house!! dun-dun-dunnn! Poor Millimans. How will they ever be able to handle me living next door to them? After all, I am a very obnoxious, noisy, pesky, stupid, emarassing-to-be-around, kid.
Hi Shelly!
Actually, I will be moving out of my lovely abode to live with my evil, wicked, dastardly, sinister, heartless, cruel, brother Dave. Here is the distressing part though; his new rented house is right next door to the Millimans house!! dun-dun-dunnn! Poor Millimans. How will they ever be able to handle me living next door to them? After all, I am a very obnoxious, noisy, pesky, stupid, emarassing-to-be-around, kid.
Hi Shelly!
Wednesday, July 05, 2006
My-Space
Ever notice how, when you browse through random blogs that 75% of them come to an abrupt end in 2004? Is this a result of My-space?
I have looked at some my-space pages and really can't figure out what makes my-space so much more coolerer than everything else.
Thoughts?
I have looked at some my-space pages and really can't figure out what makes my-space so much more coolerer than everything else.
Thoughts?
Wednesday, June 28, 2006
username
How much trouble did any of you have when picking a usename for your blog? Monday, I went and made a new blog for myself seperate from all the other blogs just so I could be somebody else. I entered in my first username wich was goodguy, then entered in my password and a fake e-mail address. Then I found out that the username was unavailable so I entered in another, wilder username. after going through the whole process of making a new blog and even posting one thing, I signed out and then went to work. At work I realiZed that I could no longer remember my username and I just spent 45 minutes this morning trying to remember it! But unfortunatel I could not remember it and I can't even delete the blog now!
Sunday, June 25, 2006
Friday, June 23, 2006
New Episode of Sharkman
NEW Sharkman episode!! Click on "Stories Galories" to read.
*note; may be confusing to those whose minds are not as highly developed as mine.
*note; may be confusing to those whose minds are not as highly developed as mine.
Wednesday, June 21, 2006
The Neverending Sto-oreeee a-a-aa-a-a-aa-a-a-aaa
YOYOYO! My name is Joe, I live near the shores of lake Ontario!
Hey aunt Priscilla, I checked out that cool blog you told me about and I even introduced a character! Now everyone has to check it out! (I think it's PG13 though so beware) There is a link on my sidebar that says "Neverending Story." So click it and read it.
Hey aunt Priscilla, I checked out that cool blog you told me about and I even introduced a character! Now everyone has to check it out! (I think it's PG13 though so beware) There is a link on my sidebar that says "Neverending Story." So click it and read it.
Thursday, June 15, 2006
A NEW POST!!!
I Haven't Posted Anything In Awhile Because I Haven't Really Had The Chance. i am alive though. dont worry. hopefully another cool post will appear shortly.
Thursday, June 08, 2006
New Blog
I have just made a new blog so that I can tell stupid stories and write about my day to day life without being too confusing.
Just so you know.
www.aplacetotellgoodstories.blogspot.com
Just so you know.
www.aplacetotellgoodstories.blogspot.com
Wednesday, June 07, 2006
Sharkman Returns
Alright, I have just had another inspiration for my Sharkman series (oh joy).
So lets see, last time I wrote about Sharkman I was describing all of his magnificent abilities because I could not think of anything else to write about him. Well one day, Sharkman is swimming about in the ocean in his Shark skin when all of the sudden, he smells trouble. So of course since he was a superheroe, he had to investigate. So, swimming faster that a fast boat, he finally reaches the spot that the trouble was coming from. Now I have never considered exactly how Sharkman can rescue people when he is a shark. Well, okay so lets say that he wasn't in the ocean because it's kind of inconvenient for me this time. (if you didn't read about all of sharkmans abilities this might not make much sense.) So sharkman is not a shark right now, he is dressed is his notorious Shark-Suit which doesn't limit him as much as being an actual shark does. This is probably going to be a confusing post.
So let's say that Sharkman was on vacation visiting his relatives in the town of Copper Harbor, Michigan, really quite a lovely spot. So as he was swimming around in the water having a jolly good time he happened to smell some trouble. Realizing that there was imminent danger to some poor soul out in the large lake of superiority, Hubert quickly ran to the cottage in which he was staying, donned his shark-suit, and dove into the water, leaving behind a bunch of bewildered relatives. As Hubert began to approach the spot he believed the trouble was located he began to get a weird feeling deep down in his stomach.
Well, it's almost time for me to leave now. I bet it feels like youre watching TV with my dad every time you read my blog (Dad would always watch 2 or 3 shows at once, flipping back and forth between commercials). Hopefully I'll finish this episode this time.
So lets see, last time I wrote about Sharkman I was describing all of his magnificent abilities because I could not think of anything else to write about him. Well one day, Sharkman is swimming about in the ocean in his Shark skin when all of the sudden, he smells trouble. So of course since he was a superheroe, he had to investigate. So, swimming faster that a fast boat, he finally reaches the spot that the trouble was coming from. Now I have never considered exactly how Sharkman can rescue people when he is a shark. Well, okay so lets say that he wasn't in the ocean because it's kind of inconvenient for me this time. (if you didn't read about all of sharkmans abilities this might not make much sense.) So sharkman is not a shark right now, he is dressed is his notorious Shark-Suit which doesn't limit him as much as being an actual shark does. This is probably going to be a confusing post.
So let's say that Sharkman was on vacation visiting his relatives in the town of Copper Harbor, Michigan, really quite a lovely spot. So as he was swimming around in the water having a jolly good time he happened to smell some trouble. Realizing that there was imminent danger to some poor soul out in the large lake of superiority, Hubert quickly ran to the cottage in which he was staying, donned his shark-suit, and dove into the water, leaving behind a bunch of bewildered relatives. As Hubert began to approach the spot he believed the trouble was located he began to get a weird feeling deep down in his stomach.
Well, it's almost time for me to leave now. I bet it feels like youre watching TV with my dad every time you read my blog (Dad would always watch 2 or 3 shows at once, flipping back and forth between commercials). Hopefully I'll finish this episode this time.
Tuesday, May 23, 2006
Another Rotten Story (cont.)

So anyway, about my story see...
So we left off with Xeno making up his mind to follow the band of ruthless raiders across the countryside. When at last the evil badguy captain named Aimvikedd came to town with his followers to pillage and plunder once again, Xeno just stayed hidden in the shadows (which made many of the villagers think he was a cowardly sparrow). He watched with fierce anger as his fellows and neighbors were beaten, bruised, and robbed of their income. When at last this merciless behavior was finished and Aimvikedd and his evil subordinates went galloping across the land to their hideout, Xeno emerged from his own little hideout, hopped on his trusty steed, and followed the easy-to-find tracks that were left by the bad guys. Now I want to name Xeno's horse. How about... Agutwahn.
You know, now I know why authors take a chapter in the beginning of a book to explain things. It makes for boring reading at first but in the long run, it's much more helpful.
Okay, Xeno was of muscular build (of course all heroes need that) and he had dark brown hair that was slightly wavy and went down to his shoulders. His eyes were darkly colored. He carried a battle sword at his right side and a smaller katana type knife-sword thing under his cloak on the same side (for he was left-handed) and a quiver of arrows slung across his back. Unfortunately for him he had no bow at this time for in his hurry to hide from the evildoers, he had dropped it on the ground. A bow in the hands of the villagers and peasants of course, was outlawed. So they had taken it away and yelled and screamed at everyone for they were desperate to know who it had belonged to. But of course the villagers would never give away their only hope for deliverance out of bondage from the raiders. Lets see..., oh yes, there was a lovely young peasant girl that he loved and wished to marry someday whose name was Marian.
Okay, that's good for now.
So he took off after the wicks and followed at a distance for days and nights. The local law enforcement at Xeno's hometown were furious with him and decided to take off after him so they could "stop him from getting hurt."
Then one afternoon, Xeno spotted Ye Olde Forest off in the distance. But then the Law enforcement officials overtook him. "Hail Xeno, keeper of the peace!" Xeno had never been called a keeper of the peace before and this quite flattered him.
"Hail Law enforcement, enforcers of the law!" Xeno replied.
"We have overtaken thee to bid thee not to enter Ye Olde Forest for thy life shall be in grave peril."
"Sires, it is my duty as a citizen of an oppressed village to attempt to liberate thee out of bondage from ye evil oppressors."
"KEEP SILENT!!" the head officer barked. "I shall tell thee what is thy duty as a citizen of my village!"
"Then pray, what is my duty?"
"Thy duty shall be to keep thy opinions to thyself just as thy fellow kinsmen hath done for an age, and to never esteem thyself as in the position to take any unneeded action against thy oppressors."
"Thou hast spoken falsely, to liberate a nation is a great duty to be performed by not only those who are oppressed, but also by those that are observing the oppression of that nation." (political agenda)
Oh no, will Xeno be able to continue his quest to liberate his village? Or will he have to be escorted back across the country by the officers? The only way to find out is... keep reading my posts. So Long For now. Peace out!!
Monday, May 22, 2006
Another Rotten Story
"Put a sock in it" he says. What a guy. I have ten minutes to come up whiththtjh a good story.
One day long ago in the kingdom of Werbahdguiz, ther lived some very bad guys. They would raid the local villages of all their riches and make off into the woods where their secret fortress was hidden in the shadows. The local athorities were strangely ignorant of these unfortunate occurances and did little to help the poor townsfolk. Then one day there arose among the peasants, a hero named Xeno. Xeno decided to follow the ruthless band of raiders across the countryside and into the dreaded forest of doom.
OH PHOOEY!! ten minutes isare up already! Well Mom, don't try to give me any ideas for this story because I already have it all figured out and I don't want you to give any of it away. (I'll love you even if you can't resist though.) until nextime, I'm Joe Fool saying so long for now.
One day long ago in the kingdom of Werbahdguiz, ther lived some very bad guys. They would raid the local villages of all their riches and make off into the woods where their secret fortress was hidden in the shadows. The local athorities were strangely ignorant of these unfortunate occurances and did little to help the poor townsfolk. Then one day there arose among the peasants, a hero named Xeno. Xeno decided to follow the ruthless band of raiders across the countryside and into the dreaded forest of doom.
OH PHOOEY!! ten minutes isare up already! Well Mom, don't try to give me any ideas for this story because I already have it all figured out and I don't want you to give any of it away. (I'll love you even if you can't resist though.) until nextime, I'm Joe Fool saying so long for now.
Saturday, May 13, 2006
Friday, May 12, 2006
Lack of Wisdom

Today I had half my wisdom surgically removed. So now I can't figure out why Mom put that picture right there and named this post "Lack of Wisdom". This picture must represent some kind of reaction to something dumb I said because of the fact that I now have the brains of a nine year old (no offense to any nine year olds that may happen to stumble upon my blog). But my jaw is feeling as if it has two gaping holes in it now! It really is quite strange all the odd thoughts that go through my mind when I'm inhaling nitrous. Like, for instance, "Why don't I just study Dr. Berger's beard since I have nothing better to do?" It really was quite an interesting beard with all it's strange coloration (black and grey) and all the precise distances between the whiskers. Enough of that for now I guess.
Friday, May 05, 2006
A Piratee Story (cont.)
After examining his helpless situation, Henry decides that the only thing to do is outsmart these vicious brutes with his infinitely superior intellect. Unfortunately he cannot think of any way to do this for all the island natives speak cannibalian and Henry doesn't know that language. Neither can he use his handy dandy boom-boom stick for it is currently lying on the bottom of the Pacific ocean. And I am currently having a hard time coming up with some spectacular escape plan for him to execute.
I guess I should start by explaining the circumstances surrounding his capture. Well, it went like this; as a fierce native was strolling along the beach one day looking for perdy sea-shells to decorate his hut with, he chanced to come across an odd piece of wood lying on the sand. After inspecting his find very carefully, he decided it was some kind of unusual weapon, and, being the kind of good natured native that he was went to see if he could find any more for his buddy. And that was how he happened to come across a most unusual specimen. Mr. Native was so excited at his unique find that he ran to the willage as fast as his to legs could carry him to bring news of his discovery to all the town board. They of course were very excited to hear about the strange weapon he had found but more importantly they wanted to know about his second discovery. After listening to Native #1 (lets call him Paco) tell his fascinating story, they all voted on whether or not to send out a group of militia to extract Henry from the beach. Following much deliberation, they agreed to dispatch a group of highly trained recon soldiers to execute their bold plan. Paco went along to see all the excitement happen. When the unit of recon soldiers got to the beach they were all flabbergasted, "Paco not joke." one soldier stated.Another pulled out a length of hemp and quickly bound the wicked man up with it. Then they all (excluding Paco) hoisted Henry's limp body up above their heads and danced off into the foliage with Paco following close behind. As soon as they got back into town, every living soul there was aghast. They had never seen such an unusual thing before. After determining that he was still in good health, the mayor decided that, since they were low on food, they would fatten him up and eat him for thanksgiving. (how horrid!) Then he awoke and sent the whole village into a panic for no apparent reason. And that is where we find him.
I still have to try and figure out how he makes his daring escape, so stay tuned for more adventures of... Henry the Cut-throat Pirate.
I guess I should start by explaining the circumstances surrounding his capture. Well, it went like this; as a fierce native was strolling along the beach one day looking for perdy sea-shells to decorate his hut with, he chanced to come across an odd piece of wood lying on the sand. After inspecting his find very carefully, he decided it was some kind of unusual weapon, and, being the kind of good natured native that he was went to see if he could find any more for his buddy. And that was how he happened to come across a most unusual specimen. Mr. Native was so excited at his unique find that he ran to the willage as fast as his to legs could carry him to bring news of his discovery to all the town board. They of course were very excited to hear about the strange weapon he had found but more importantly they wanted to know about his second discovery. After listening to Native #1 (lets call him Paco) tell his fascinating story, they all voted on whether or not to send out a group of militia to extract Henry from the beach. Following much deliberation, they agreed to dispatch a group of highly trained recon soldiers to execute their bold plan. Paco went along to see all the excitement happen. When the unit of recon soldiers got to the beach they were all flabbergasted, "Paco not joke." one soldier stated.Another pulled out a length of hemp and quickly bound the wicked man up with it. Then they all (excluding Paco) hoisted Henry's limp body up above their heads and danced off into the foliage with Paco following close behind. As soon as they got back into town, every living soul there was aghast. They had never seen such an unusual thing before. After determining that he was still in good health, the mayor decided that, since they were low on food, they would fatten him up and eat him for thanksgiving. (how horrid!) Then he awoke and sent the whole village into a panic for no apparent reason. And that is where we find him.
I still have to try and figure out how he makes his daring escape, so stay tuned for more adventures of... Henry the Cut-throat Pirate.
Thursday, May 04, 2006
A Piratee Story
Once upon a time, in the oceans of the south pacific, there lived a dastardly wicked pirate named Henry. Henry was feared by all men, dead and alive and he was nearly invincible. He had the bestest of ships and an extraordinarily evil crew. He would often go out pillaging and plundering upon the high seas and send stark terror into the hearts of sharks everywhere.
Anyway, one day Henry's ship ran into rocks in a fierce storm and sank to the depths of the sea drowning every one of his crewmembers. Henry was the sole survivor of the terrible wreckage and was left to be tossed to and fro on the violent waves with nothing but a large chunk of spalted maple to keep him afloat. After drifting for days out in the middle of no-mans-land, Henry spotted land. But if you think that he could just swim to shore like nothing after drifting around helplessly for days with no food or good water you should work in hollywood. He had to wait till the current pulled him closer to shore before he even considered making a swim for it. It was a long and arjuous swim for him and when he finally got to shore he dragged himself up high enough so that the tide wouldn't get him and fell fast asleep. When he awoke, he was surrounded by angry natives who looked frighteningly hungry. Carefully examining the situation, Henry thought up a bold plan.
END OF PART ONE. PLEASE FLIP TAPE OVER TO HEAR PART TWO.
or just wait till I think up a bold plan for Henry to execute
Anyway, one day Henry's ship ran into rocks in a fierce storm and sank to the depths of the sea drowning every one of his crewmembers. Henry was the sole survivor of the terrible wreckage and was left to be tossed to and fro on the violent waves with nothing but a large chunk of spalted maple to keep him afloat. After drifting for days out in the middle of no-mans-land, Henry spotted land. But if you think that he could just swim to shore like nothing after drifting around helplessly for days with no food or good water you should work in hollywood. He had to wait till the current pulled him closer to shore before he even considered making a swim for it. It was a long and arjuous swim for him and when he finally got to shore he dragged himself up high enough so that the tide wouldn't get him and fell fast asleep. When he awoke, he was surrounded by angry natives who looked frighteningly hungry. Carefully examining the situation, Henry thought up a bold plan.
END OF PART ONE. PLEASE FLIP TAPE OVER TO HEAR PART TWO.
or just wait till I think up a bold plan for Henry to execute
Wednesday, May 03, 2006
A Few Good Stories
I am afeared that sharkman may die. I can't seem to come up with any good ideas.
Once upon a time, there was a lowly peasant whose house got burninated by a big, mean dragon named Trogband. So the peasant swore revenge upon the dragon and set out upon a fateful quest to kill him. Then peasantman got the supertrinket and used it to buy his way into the archery bow winning contest and of course he won with great ease and then he killed the Ogre and fell in a mud puddle and got his good shirt all dirty and then it's all over the end.
Once upon another time there was a little boy who wished for a better life. But unfortunately, his wish was never granted, THE END.
One day, the good king went out upon the balcony-thing to survey his kingdom. Suddenly, from out of nowhere came a big fat ugly... *GASP*... PIZZA DELIVERY GUY!!
One day a man met his doom the end.
Once while I was being dumb, I got hurt.
This is the story of a courageous young warrior named Xeno. He charged the ranks of the goblins of Mount Gram in the battle of the green fields, and knocked their king golfimbuls head clean off with a wooden club. It sailed a hundred yards through the air and went down a rabbit hole. And in this way the battle was won and the game of golf invented in the same moment.
Now that I have completely exhausted all my story-telling abilities, I must beg of you to help me come up with more lovely stories such as these that I have just told you. All your ideas are welcome... maybe.
Once upon a time, there was a lowly peasant whose house got burninated by a big, mean dragon named Trogband. So the peasant swore revenge upon the dragon and set out upon a fateful quest to kill him. Then peasantman got the supertrinket and used it to buy his way into the archery bow winning contest and of course he won with great ease and then he killed the Ogre and fell in a mud puddle and got his good shirt all dirty and then it's all over the end.
Once upon another time there was a little boy who wished for a better life. But unfortunately, his wish was never granted, THE END.
One day, the good king went out upon the balcony-thing to survey his kingdom. Suddenly, from out of nowhere came a big fat ugly... *GASP*... PIZZA DELIVERY GUY!!
One day a man met his doom the end.
Once while I was being dumb, I got hurt.
This is the story of a courageous young warrior named Xeno. He charged the ranks of the goblins of Mount Gram in the battle of the green fields, and knocked their king golfimbuls head clean off with a wooden club. It sailed a hundred yards through the air and went down a rabbit hole. And in this way the battle was won and the game of golf invented in the same moment.
Now that I have completely exhausted all my story-telling abilities, I must beg of you to help me come up with more lovely stories such as these that I have just told you. All your ideas are welcome... maybe.
Tuesday, April 25, 2006
A Story with a Moral
Once upon a time in the fair kingdom of braunmont, there lived a lowly pheasant. Then the pheasant got shot by a peasant. Then the peasant (we'll call him Ed) robbed the mighty king of all his wealth and made off into the woods were he was promptly eaten by savage mosquitoes. Proving once and for all that you shouldn't steal. You can probably tell that I have no clue what to write about, and the Sharkman story hasn't had any more inspirations so far. But keep looking, I'm bound to have some interesting story to tell someday. Ideas anyone?
Friday, April 21, 2006
Sharkman Tries to Continue
From this point I am a bit confused as to where I should go next with this Sharkman thing. I guess that I'll try hard to make all you Sharkman fans happy!
Last time on Sharkman:( We learned that as Hubert was having a swim in shark infested water near a nuclear power plant he was chomped by a big shark and then he turned into a shark himself... Yeah.... Now for:) Sharkman Returns (although I didn't know that he had left)
I guess I really don't have any ideas after all. Oh, but I must discuss his superness more completely. Ok, first of all he only turned into a shark when he was in salt water (He was a shark on the beach before because his swim trunks were wet) but whenever he wanted to be a shark in freshwater he was distraught, for he could not turn into a shark then. (Boy this is a strange story!) But it was this unfortunate occurrence (or "unoccurrence") that lead to the construction of his notorious shark suit which struck sheer terror into the hearts of evildoers everywhere. Other than the unnatural ability to turn into a shark, Hubert also got a slew of other abnormal qualities about himself that I will list here.
The Superswim: This was the power to swim very vast even when he wasn't a shark.
The Superchomp: This power came in real good handy when he went out to fancy restaurants like Applebee's and ordered a piece of steak.
The Watersniff: The ability to smell trouble in the water from two miles away.
The Iron torso: A very strong torso (which, by the way, no good superhero can go without).
And Finally, The Sharktongue: This allowed him to converse with any shark he pleased (which came in handy dandy later on).
Last time on Sharkman:( We learned that as Hubert was having a swim in shark infested water near a nuclear power plant he was chomped by a big shark and then he turned into a shark himself... Yeah.... Now for:) Sharkman Returns (although I didn't know that he had left)
I guess I really don't have any ideas after all. Oh, but I must discuss his superness more completely. Ok, first of all he only turned into a shark when he was in salt water (He was a shark on the beach before because his swim trunks were wet) but whenever he wanted to be a shark in freshwater he was distraught, for he could not turn into a shark then. (Boy this is a strange story!) But it was this unfortunate occurrence (or "unoccurrence") that lead to the construction of his notorious shark suit which struck sheer terror into the hearts of evildoers everywhere. Other than the unnatural ability to turn into a shark, Hubert also got a slew of other abnormal qualities about himself that I will list here.
The Superswim: This was the power to swim very vast even when he wasn't a shark.
The Superchomp: This power came in real good handy when he went out to fancy restaurants like Applebee's and ordered a piece of steak.
The Watersniff: The ability to smell trouble in the water from two miles away.
The Iron torso: A very strong torso (which, by the way, no good superhero can go without).
And Finally, The Sharktongue: This allowed him to converse with any shark he pleased (which came in handy dandy later on).
Tuesday, April 18, 2006
Sharkman Begins
No, it is not haddock day anymore. But it is the first time in quite awhile that I have had a chance to get on the blogger. But, it seems that I have all kinds of fantastic ideas of things to blog about but I always forget them when I get on the computer. Perhaps I shall tell you a story about the menny avencherz uv... SHARKMANN!! Dananananananananananananananana SHARKMANN!!!! Oh deere, I'm drawing a blank.
Once upon a time there lived a man who loved to swim. One day... Hubert (that was his name I guess) decided to go for a swim near a nuclear power plant. Don't ask me why he decided to do that because I really have no clue. But it just so happened that there was a rather large and sinister looking shark swimming near the same power plant on that very same day who promptly bit Huey's pinkey fingers off and swam away laughing. Now Huey was not the excitable sort and, examining the situation carefully, decided that the best thing to do was to get out of the water (a logical idea in my opinion). So Hubert swim for shore and save himself and, feeling a bit drowsy, decided to drive home and take a nap. unfortunately for him his car had mystyriously fallen off a large cliff and exploded. Deciding at last that there was nothing better to do he lew himself down and dozed off right on the beach. when he awoke, he had a strange inclination to go for another swim and, feeling nothing better to do (which, quite often in Hueys life there was nothing better to do) began to try and get up. But for some reason beyond his guessing, try as he might he could not manage to get himself up. But he soon discovered that rolling himself over and over was not only for children but for him too (at least it was at this point in time). The water was looking ever so good to him at the moment and for the life of him he couldn't figure out why (He also greatly desired a tuna fish sandwich). He was much relieved when, at last he splished into the water. He somehow found the water unusually comfortable and began swimming around. And in this way, Hubert learned that, over the period in which he was peacefully sleeping, he was also peacefully turning into a shark.
Once upon a time there lived a man who loved to swim. One day... Hubert (that was his name I guess) decided to go for a swim near a nuclear power plant. Don't ask me why he decided to do that because I really have no clue. But it just so happened that there was a rather large and sinister looking shark swimming near the same power plant on that very same day who promptly bit Huey's pinkey fingers off and swam away laughing. Now Huey was not the excitable sort and, examining the situation carefully, decided that the best thing to do was to get out of the water (a logical idea in my opinion). So Hubert swim for shore and save himself and, feeling a bit drowsy, decided to drive home and take a nap. unfortunately for him his car had mystyriously fallen off a large cliff and exploded. Deciding at last that there was nothing better to do he lew himself down and dozed off right on the beach. when he awoke, he had a strange inclination to go for another swim and, feeling nothing better to do (which, quite often in Hueys life there was nothing better to do) began to try and get up. But for some reason beyond his guessing, try as he might he could not manage to get himself up. But he soon discovered that rolling himself over and over was not only for children but for him too (at least it was at this point in time). The water was looking ever so good to him at the moment and for the life of him he couldn't figure out why (He also greatly desired a tuna fish sandwich). He was much relieved when, at last he splished into the water. He somehow found the water unusually comfortable and began swimming around. And in this way, Hubert learned that, over the period in which he was peacefully sleeping, he was also peacefully turning into a shark.
Wednesday, April 05, 2006
Haddock day
Howdy howdy howdy! I cant think of anything groovy to write about today. Oh yeah, today is haddock cleaning day at work so I must be very prepared to clean 65 libras of foosh, or feesh, or fash, or is it foshes. It is usually a lot of fun because me and Joel whisper and laugh at random foolishness and then danielle gets very cranky because she always thinks that we are laughing at her. We really only very rarely ever laughed at her and I don't think that we actually have in quite some time now so she really has no need to get so distraught over the whole thing. Although one time I did march up to her one time with a wet, cold, slimy fish in my hand and slapped her in the face with it, which of course made everybody laugh uproariously except for Danielle. Her face has dripping and had pieces of raw haddock all over it. Okay, so that part dinnit really happen.
Monday, March 27, 2006
Jumbled thoughts on my trip to Mississippi.
Todasy iejnhvklshoifvkjblnsedy... Today is my first full day back at home. As you may have seen I spent the last nine days out of town. I went with a group of guys from CCW, CCFL, and CCN (Calvary Chapel Webster, Finger Lakes, and Newark) to Mississippi to help people fix their houses. Can you understand what I just wrote?? Oh well. Anyhow, we all had a blessid time and I cant write good today and I don't know why. ahahahahahahahahahahaaaaaaaaaaaaaaaaaaa!!! But I did make some groovy new friends like Joseph Frascatore, and his daddy Tom, And George "Humble" Humby, and... oh it would take a while to go through all of the groovy dudes that went. But it was a fun time.
Monday, March 20, 2006
The Imposter
Joe can't be here today. He is not home. He went on a long trip. He is in Biloxi, Mississippi. That is all for today.
Tuesday, March 14, 2006
Tuesdays
"Porridge today Gromit, Tuesday." Nate just made himself some oatmeal for breakfast but he dinnit make any for anyone else! "I think I'll get my own porridge." Maybe I should just make some yummy eggses! Or some crunchable birdses! Mmmm, juicy sweet. Haha, I am such a doofas.
Today is, as I said, Tuesday, and I very strongly dislike working on Tuesdays because I work with a bunch of girls that like to tell me how everything is done and how I always burn stuff which is not true (not that I can remember anyway). They always seem very ready to boss me around all day while they stand around and chit-chat like women do. "Joe, I dont want to do that job so you can do it, and when your done you can do all those other jobs that I hate. I'll just stand here and talk about all the troubles in my life." Then I have to train Nancy on the fryer which is really quite hopeless because she never listens to anything I tell her. She's always giving the customer vegetable oil sandwiches and stuff like that. Yes, Working at Orbakers on a Tuesday when I am the only Guy there during the day is quite an endeavor.
Today is, as I said, Tuesday, and I very strongly dislike working on Tuesdays because I work with a bunch of girls that like to tell me how everything is done and how I always burn stuff which is not true (not that I can remember anyway). They always seem very ready to boss me around all day while they stand around and chit-chat like women do. "Joe, I dont want to do that job so you can do it, and when your done you can do all those other jobs that I hate. I'll just stand here and talk about all the troubles in my life." Then I have to train Nancy on the fryer which is really quite hopeless because she never listens to anything I tell her. She's always giving the customer vegetable oil sandwiches and stuff like that. Yes, Working at Orbakers on a Tuesday when I am the only Guy there during the day is quite an endeavor.
Wednesday, March 08, 2006
Killer Looks
Tuesday, March 07, 2006
Sorry Brian
Today is tuesday, March... 7th? Any way, on saturday me and my friend Brian went to Brantling hill in Sodus to go snowboarding ( oh yeah, his sister Heather went too, LOL). It was quite frusterating for me at first becuase every time I tried to turn I fell on my bum. Brian tried to encourage me by saying that that stuff always happens and to just stick with it. And me, being all flummoxed, would always respond to him kind of sharply (not to be rude but just cause I was irratated and embarrassed at falling down on the bunny hill. So I think I made Brian mad at me for that but I really didn't mean to.
And then at about 3:30 PM I fell backwards after hitting a little bump and hit my head and got a head-ache and then I dinnit feel like snowboarding any more but Brian did and he got all dissappointed... Grrr. Maybe I'll go agian sometime and do better and not get so irratated and hurt my good friends feelings. Sorry Brian.
And then at about 3:30 PM I fell backwards after hitting a little bump and hit my head and got a head-ache and then I dinnit feel like snowboarding any more but Brian did and he got all dissappointed... Grrr. Maybe I'll go agian sometime and do better and not get so irratated and hurt my good friends feelings. Sorry Brian.
Friday, February 17, 2006
my life story
I am getting tired of cooking french fries for six hours a day. I want to do something else with my life now. I'm sure that there are millions of kids who feel the same way. If I was making $8 an hour like all the other cooks there I wouldnt mind so much but I make miminum wage, wich I guess is better than nothing.
Thursday, February 16, 2006
Of the US Military
Today I would Like to let everyone be aware that I am considering joining either the Army or the Army National guard. Yes weep for me, lift up your voice and lament for my time has come to leave this wretched place and become who I was born to be!
But really, why is it that whenever I mention to somebody that I may join the U.S. military, they try to convince me not to? They say stuff like, "No I don't want you to get shot", and "You're too smart for the military". I may be too smart for the military I guess (haha) but... then again, maybe they need some edumicated... WAIT A MINUTE!! To everyone who thinks that the military is made up of stupid kids who couldn't get any other job I advise you to think again. The U.S. military is chok full of highly intelligent kids from all over the country.
I have to go to work now. Bye bye
But really, why is it that whenever I mention to somebody that I may join the U.S. military, they try to convince me not to? They say stuff like, "No I don't want you to get shot", and "You're too smart for the military". I may be too smart for the military I guess (haha) but... then again, maybe they need some edumicated... WAIT A MINUTE!! To everyone who thinks that the military is made up of stupid kids who couldn't get any other job I advise you to think again. The U.S. military is chok full of highly intelligent kids from all over the country.
I have to go to work now. Bye bye
Monday, February 13, 2006
I Dont Know What to Write
For the first time in... awhile I get to post something! Now, what should I post?
How about I post an essay that I have written. Tell me what you think.
Dear Editor,
I am absolutely disgusted at the December 5 editorial which stated that there are no military heroes. What an unpatriotic thing to say! U.S. Soldiers are daily putting their lives on the line to defend our country and we thank them by saying “there are no military heroes”?? That sickens me!
And saying that our military personnel are trained “shoddily” is a direct insult to all of our armed forces. I personally know three marines and I can assure you, they are not trained “shoddily.”
Also, before being too quick in saying that we are the aggressor in this war, remember September 11 (an event to which we all said “we will never forget”), and remember also, the U.S.S. Cole. We are not the aggressor.
One more thing, liberating millions of people from the grasp of a ruthless mass murderer is not what I call “morally wrong.” I honestly can’t understand why some people insist on lowering our troop’s morale.
Remember, greater love has no man than he who lays down his life for his friend.
Sincerely,
Josiah Teal
That one actually got published in the Rochester Democrat & Chronicle on Dec. 18, 2005. I was so pleased (although it did get edited by the editor).
How about I post an essay that I have written. Tell me what you think.
Dear Editor,
I am absolutely disgusted at the December 5 editorial which stated that there are no military heroes. What an unpatriotic thing to say! U.S. Soldiers are daily putting their lives on the line to defend our country and we thank them by saying “there are no military heroes”?? That sickens me!
And saying that our military personnel are trained “shoddily” is a direct insult to all of our armed forces. I personally know three marines and I can assure you, they are not trained “shoddily.”
Also, before being too quick in saying that we are the aggressor in this war, remember September 11 (an event to which we all said “we will never forget”), and remember also, the U.S.S. Cole. We are not the aggressor.
One more thing, liberating millions of people from the grasp of a ruthless mass murderer is not what I call “morally wrong.” I honestly can’t understand why some people insist on lowering our troop’s morale.
Remember, greater love has no man than he who lays down his life for his friend.
Sincerely,
Josiah Teal
That one actually got published in the Rochester Democrat & Chronicle on Dec. 18, 2005. I was so pleased (although it did get edited by the editor).
Friday, January 27, 2006
Hooray hooray!
Finally, a blog of my very own! This is something I have desired to do before I knew that blogs even existed. I was doing them on my word processor before. to bad nobody will ever be able to read all that good stuff, I always laugh hysterically whenever I read those. Now every one will be able to laugh hysterically!!!
actually that right there wasn't very funny at all.
actually that right there wasn't very funny at all.
Subscribe to:
Posts (Atom)


