One day, a very geeky, dorky, nerdy kid named Joe delivered a pizza to somebody's humble abode. He knocked on the door and a strange old man answered from somewhere inside. His voice was very raspy and nearly indiscernable but Joe could barely make out the words "Come on in but don't step on the rug, it's been rigged."
What happens next?? You decide. Continue my story.
Thursday, September 21, 2006
Monday, September 18, 2006
blah
Oh boy, another post.
I am at the library right now and I can't think of anything exciting to say.
I am at the library right now and I can't think of anything exciting to say.
Tuesday, September 12, 2006
SMART!!!!!!!!!!!!!!
Blog blog blog blog blog.
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
Subscribe to:
Posts (Atom)
