Saturday, November 22, 2008

nothing good

Yes, for some reason I cannot think of anything that I want to post on the internet for all to see right now (except for this) but I just wanted to say that I cannot do that little 6th picture of the 6th folder thing when I don't even have any pictures... I'm sorry Aunt Priscilla. :(

Friday, November 14, 2008

Fan Appreciation Day

Dear fans,
I write to you today to express my deepest gratitude for your unwavering devotion to my ramblings. I wanted to take this moment to say thank you, thank you for your support and all the kind words you have expressed to me over the course of the last two and 2/3 years I have been blogging. Times have been tough in the past, but you had faith in me, and for that I thank you, you have been an unending inspiration to me and the source of many revelations.

Insincerely - Josiah Teal


That is a joke, just in case you were wondering. I wanted to see if I could write a convincing letter of appreciation... did it work?

Actually, I wrote that because I was in the mood for writing but didn't know what to write about. Oh! How about this:

Recently, I began work on a cheesy tale of goofiness for fun and stuff. It is the story of The Christmas Ogre and it will awe, inspire, amuse, and bring comfort to all who are unfortunate enough to read its dreadful pages. About... 2-3-4 years ago, me and my younger brother Ben began writing one but it has since been lost to the fog of time. So I began writing a new one. I hope it is good... I hope this post is not completely pointless and boring :(

Tuesday, November 11, 2008

Veterans Day

Seeing as it is now the 90th anniversary of Armistice Day, I would like to take a minute to honor all of the American veterans who have put their lives at risk to keep us safe. I also think of those who did not serve in active combat but rather spent their time fixing broken plane and tanks and such, and those who fixed the broken soldiers. I am a big fan of our military and I believe that our soldiers should be respected.

Anywho, again, thank you all you veterans and those currently serving, whether you saw action or not, your work is appreciated by me. Now let me see if I can find a nice picture to swipe.



I think that is a good one.

Saturday, November 08, 2008

No Title

New post on my story blog, I hope you will take a few minutes and take a peek :)

Thursday, October 30, 2008

Is America the Villain?

One thing that has been on my mind lately: Is America the villain?

When we watch movies and TV we often come across a story in which the big governing body is being a menace to other nations, like The Alliance in Serenity/Firefly, the Empire in Star Wars, and even in real history, Germany in WWII, and Britain during our fight for independence between the years 1776 and 1783.
Do other nations envision our soldiers as Storm Troopers?

Reasons for Past Conflicts

All one really needs to do in this case is look at what we have fought for in the past; WWII, to stop the spread of evil in Europe and (while also protecting our own interests) liberate nations conquered by the Nazi War Machine; Vietnam, to quell the spread of communism; Gulf War, to protect a small country while also protecting our oil interests; the War in Iraq, to liberate an oppressed people and to fight terror.

Occupations

One must remember also that occupations are often present after a war. This is to ensure that utter chaos does not ensue as a result of an overthrown government and the establishment of a replacement government. If, when Germany was defeated in WWII, we left them to fend for themselves, we would have done little to prevent the wrong person from coming to power in a time of chaos... this gets complicated.

Unfortunately, occupations can also yield some of the worst sides of people. Murder and vandalism often result after the conquering soldiers become more relaxed and less disciplined. They will drive tanks over cars and do other unspeakable things. One must remember that these are the actions of individuals who make bad choices, not the government itself.

The Good Side of America

Despite our more selfish (so to speak) reasons for becoming involved in some past wars, I find it hard to imagine the U.S. as a villain. We have liberated people and countries, we have helped to spread democracy and overthrow murderous dictatorships, and shielded other nations from falling into the hands of people such as Adolf Hitler and Saddam Hussein (let's be clear that these were bad people, killing innocent people for ethnic cleansing or for sport is bad. No matter where you are from, this is wrong). We are the most generous nation on the planet. We give more to foreign aid and relief efforts abroad than any other nation and that is a fact.

The Other Side of America

So why do some countries label us as the villain? Some things that come to mind are Hiroshima and Nagasaki, we dropped the atomic bomb on both of these cities in August, 1945. These were cities populated with non-combatants. In the mind of most of the world this was terrorism. Although this was not one of the proudest points in American history, many point to the idea that WWII would have lasted much longer and claimed many more lives if it did not happen. Slavery in America is another issue, although the nation was at one time completely divided over it, some nations still scoff at America for having practiced it. Is there slavery in America now? We have sad points in our history yes, but so do all nations.

My Conclusion

After contemplating various issues on the subject, I have decided that our Marines are not the equivalent of Nazis or Storm Troopers, and our leadership is not (not yet) the same as Hitler or Darth Vader. I think an unbiased look at the facts of history and where America currently stands will show, America is not the villain.

I think that pretty much covers it.

Two Different Posts in One!

So as I logged in to my blog this morning I noticed something unusual at the top of the page. My adsense was no longer present. Confused, I quickly checked my E-mail to find that google had disabled my account. The reason was unspecified, but I think it was because it was doing rather well this month, bringing in about $25-$30. I had feared that this may happen; I had read the testaments of several people who were very upset at the fact that their accounts had been dissabled right before their first check would be sent to them. I guess that's is what happens though.... Maybe it was because I mentioned my ads in the last post... I didn't think that was illegal, in fact, it isn't.



Anyway, what I was going to blog about was, of course, political. It is that time.

I think at the top of my list of reasons not to vote for Barrack Obama would be because of what we like to call National Security, as demonstrated in the following video clip.




That's about all I can say there... but wait, theres more.

1. Obama is sympethetic with our enemies.
2. Our enemies like Obama and want him to win the election.
3. Obama want's to disarm America and Americans.
4. Obama is not a fan of America.

Why would we let him become president??
CHANGE! Yay, let's change!

Please define this change Mr. Obama.

Tuesday, October 28, 2008

Sociological Thoughts

Yeah so, I don't really know how I got body armor ads up there, but I think it's cool anyway.

Anyway, I wanted to take the time in this post to address things that were in my head from last night sociology class. For the most part, I think sociology is common sense, for example, things like, "We change our behavior based on other peoples reactions to it." If I were to pass gas loudly in public, people would make faces or get mad at me and that would indicate to me that passing gas loudly in public is not the best thing to do. I therefore refrain from doing so again... common sense stuff right?

The things that don't seem to make as much sense are these; "there are no absolutes", "right and wrong are relative to the culture that defines them", "Even murder, child rape and stealing have their respectful place in certain societies."
Is this true?? Of course I know it is false, but I would like to get more involved in it than just saying "that's wrong."
Let's address murder, shall we? Killing is not necessarily murder although murder is killing. If I were to kill in self defense, the law would be on my side (for now). When I brought this up, my professors first response was to brig up the disarming tactics used in martial arts such as Judo. (for the story of judo) He claimed that in the country where judo originated, killing in self defense was considered murder and the citizens used Judo to disarm and subdue an attacker. He therefore conceded that maybe all killing was really murder. I quickly brought up the fact that most westerners do not know Judo and therefore often have no other reliable means of self defense other than using deadly weapons.

If I were to kill out of jealousy or hate, that would be murder. Killing enemy combatants in wartime is not murder, killing civilians is. "So what about armed civilians?" my teacher is a tricky guy. My question is, do the civilians become combatants when they are armed? Is it therefore justified when they are killed? This is tricky business.

It seemed as if the issue was being slightly skirted. "Is killing out of jealousy or hate or whatever universally murder?" This question was largely unanswered. For myself, I cannot think of an exception to this rule.

As for child rape, the practice of arranged marriages was the reason child rape is not universally wrong. Arranged marriages are the cultural norm for some cultures and therefore, child rape must be accepted as well. This is the reasoning of my sociology professor. Respectfully, I must disagree. I feel I need not explain the reasons for this.

Stealing... is stealing wrong when one steals to survive? Or to feed a hungry child? Even the Bible makes an exception for this rule. In the book of Proverbs it states that we are not to punish the man who steals to feed himself or (I would assume) somebody else; however, they are expected to repay whatever was stolen when they are able to do so.
The Bible is not relevant to (according to my professor) 2/3 of the worlds population so what it has to say is not sociologically relevant... I would disagree with that. Here is why... briefly.
The Bible has a lot to say about good and bad, right and wrong, truth and lies, and much more. Would one be so bold as to say that any one of those things the Bible describes as right or wrong is... well, wrong? What makes them so sure? Are you right in saying there is no right or wrong... or are you wrong?

This has turned into more of a rant than I meant for it to be... but I hope you get what I'm trying to get at.

At the epitome of sociology there seems to be a theory that everything is relative... nothing is absolute. Can you think of one thing that is a universal truth for all societies? it is hard when one is to rule out things such as murder, rape, stealing, and even terrorism. According to sociologists, terrorism is an accepted way of doing things in certain places and it is therefore right to those who accept is (no way).

I might continue this later... then again, I might not.

Thursday, October 23, 2008

Hopes and Aspirations

After learning that my good friend Josiah Slocum has some writing talent of his own, we have decided to write a series of short books/stories for all to enjoy and for us to enjoy writing. I am hoping that this doesn't turn into anther one of our many failed endeavors (such as making short movies... we still don't have a camera for that), and I also hope that we can both find some spare time to come up with fantastic ideas and good characters.

Some of Joe's writing here:

"as the sun grew hotter and the flowers scent filled the air i look towards the sky and..."

"with a look of mischief between 2 friends and the imminant departing that soon would follow."

"as winter approaches one must reflect on a summer of fun and new memories as well as the possibility of the sunburn that i prolly had gotten.lol."

So that's just a sample of the writing style of Slocum, it's a little different than mine, but that's what makes it so that the combination of our writing techniques will be the awesomest thing ever!

_________________________________________________________________

So I re-started writing a screenplay for a story that's been floating around in my head for the last few months and I'm hoping that it turns out super spectacular... oh it will, it will. Anyway, I found out that one of the hardest parts is writing the personalities of my characters out on paper... well, virtual paper. In my head, I know what all of their various personalities are like, but trying to write them out is a challenge as I have to describe things that they do ei: hobbies, quirks, favorite foods, as well as ages, names (wich is hard for a sci-fi/fantasy story), hair color, and clothing preferances.
All the little details in between major plot points is also a tricky thing. I had always thought of only the big picture of the story and not as much about the fillers, but the pace needs to slow down sometime, otherwise the audience will get overwhelmed.

Anyway, that's all for now, I'll catch up on other blogingtons now, so peace out everyone!

P.S. Happy birthday to Bethany!

Tuesday, October 21, 2008

moved

Post post post, that's all I'm good for.

Anyway, I have moved (mostly) from Dave and Leta's abode to Beth and Adams. It's closer to school and stuff so that will be good. My cat and louis will have to learn to get along... surprisingly it's my cat who is the meany-head.

Monday, October 13, 2008

Refined Narrative, YAY!

Here is my refined story of bees and stuff for all to enjoy! :)


Recklessness; it’s what makes young boys tick. For me being reckless was a part of everyday life, whether it was jumping off of a garage roof onto a trampoline (not agood idea), or stopping the inner tube in the middle of a water slide so that the person behind me could catch up. The thrill of being reckless was often too much to resist and I would often suffer the consequences, and they would almost always hurt.

When I was 12, my friend Kadan and I decided it would be a good idea to try and take out some wasp nests by throwing chunks of dirt at them. Were there better ways to get rid of wasp nests? Yes, there were, but this was definitely one of the more adventurous ways to do it. I don’t think we started out that morning saying to each other, “Hey man, lets throw chunks of dirt at wasp nests and get a huge adrenaline rush!” But as the day wore on and we got more and more bored, things just fell in place.

Kadan lived on a sort of miniature farm with goats and chickens and such, and was surrounded by corn fields. There were several barns scattered randomly across his property and each one of them had about a dozen wasp nests attached to it. As we were moseying along outside wondering what we could possibly do to pass the time, we spotted some of these wasp nests on a couple metal storage units for his family’s tractors. “Hey,” I said excitedly, “can we get your BB guns and shoot those down?” Kadan wasn’t too enthused about the whole idea, probably because we really weren’t supposed to shoot at the buildings. He promptly shot my idea of a good time into a billion pieces with a harsh, “NO!” I felt like a whipped puppy. But I wasn’t going to let
his dreary attitude dampen my spirits for long. I meandered over to the corn fields and sat
down. Kadan soon followed and sat down next to me. I think we were both pondering the
prospect of a lackluster afternoon and how neither of us wanted to live through one of those.

I reached into the cornfield next to us and pulled out a hard chunk of dirt. I fiddled with it for a little while, breaking pieces off and crumbling them between my fingers. I threw a piece off into the grass where it exploded with a small puff. “Hey,” I thought to myself, “that’s kind of groovy.” I picked up another piece and gave it a toss with the same results. Kadan picked up on what I was doing and joined in the fun. Soon we were seeing who could throw farther while sitting down. I would like to say I could, but in reality I think it was a tie. I started to cheat. I stood up and let a few fly. Kadan did the same and soon we were going crazy, letting chunks of dirt fly in all directions. It wasn’t long before one of them hit a barn quite close to one of it’s many decorative wasp nests. The wasps responded by buzzing passionately around their abode trying to discover what had disrupted their calm lives. I looked at Kadan and we both smiled sadistically as we rushed to get more ammunition from the corn fields. We scooped up as many chunks as we could and rushed back to the barn where we lobbed a continuous stream of dirt at the humble wasps who began to get very irate at our meanness, although they couldn’t figure out it was us. We tried several different tactics to get the best shot at the nests; direct hits, shrapnel, they were all fun and exciting and very spectacular. We eventually knocked the nest down. We didn’t hesitate however, to locate another nest and begin to assail it with the same barrage of weaponry and tactics we had so skillfully employed on our last endeavor. These wasps responded with the same frustration as the last ones, and understandably so. We laughed devilishly as each missile exploded and the fury of the wasps raged on.

Knocking down nest after nest never seemed to get old until we decided to end our mission by taking out the biggest nest of all. We thought it similar to fighting the end boss in a video game. The nest was located inside an overhang right above a tractor tire. At first we employed the sniper method; standing far away as we sent our projectiles sailing through the air toward our target. We did have good aim but our weapons were not causing any damage. “That armor’s too strong for blasters!” I said in my excitement. Unfortunately, my little joke went unnoticed by Kadan, who had never seen Star Wars.

Soon we realized that we had to rethink our strategy for this particular “enemy installation.” Kadan decided to implement a sneak attack approach: we would sneak inside the building and climb on top of the tractor’s right tire. Standing up slowly, our plan was to launch a huge chunk of dirt at the nest by hurling it straight up. The get away was the fun part: after our massive bomb had exploded, we would jump down and crouch in the corner of the building, hoping that our enemies wouldn’t detect us, and then when the timing was right we would rush outside to safety. We had to take turns for this tactic, as it was too dangerous to go in full force. I was a wimp I guess, because I volunteered to go first. I sneaked inside the building and slowly scaled the massive tire. Ammo in hand, I cautiously stood up and prepared to fire. Mustering up all the foolishness I had in me, I let my ordnance fly. It exploded directly next to the wasps base and sprayed it with dusty shrapnel. Kadan howled with laughter as I quickly jumped off the tire and crouched in the dark corner. The wasps were buzzing viciously around the nest trying to uncover the source of the disturbance. I stayed crouched in the corner and waited for my adrenaline to tell me when to make a mad dash out of there. I ran. I didn’t get ambushed on the way out either.

Ahh, safe again, but now it was Kadan’s turn. He went about his duty in much the same way as I had, slowly scaling the tire, only his mission was a lot more hazardous than mine was: the wasps were already buzzing with ferocity! I watched from what I thought was a safe distance as Kadan released his bomb into the nest. It was a direct hit and no sooner had his dirt chunk exploded than I finally felt the wrath of an angry wasp. It dove at me right from the nest, swooping down like a dive bomber at an air show. The nerve of that bug! He didn’t even bother to land on me, he just swooped down with his rear end pointed right at me and stung me, stung me right above my left eye. I hollered and ran off through a trail that lead down the corn fields. I wasn’t wearing any shoes and some of the plants were hard and stabbed my feet but I didn’t care, all I knew was that I got stung by one wasp and for all I knew the whole nest was after me. I’m sure I broke a sprinting record of some kind that day, I don’t think I’ve ever run faster. Once I thought I was far enough away I stopped running and sat down, rubbing my eye which both itched and stung terribly at the same time.

Soon Kadan came trotting up the trail to where I was sitting. He was laughing, laughing! How could he be laughing? Didn’t he know that I got stung? Didn’t he know that getting stung hurt? The more I thought about it, the more I realized why he was laughing. We had been
bombarding wasp nests for an hour and a half straight, aggravating so many bugs and I
got stung; I got stung and I couldn’t take it. I felt like such a pansy. I stood up and laughed with him. “I guess that wasn’t really a safe thing to do” I muttered.

Kadan just smiled and said, "Do you want to go play with rusty bear traps and find some evil snakes."

I stopped rubbing my eye and grinned, "That sounds like fun." I replied, and off we went down a dark wooded path.

Friday, October 03, 2008

For Sale

For sale: Broken computer peices, $100.00.

Playstation 2 without controller, $300.00.

Wonderful coin collection, $10,000.00!

Yeah, I only wish I could get that much for useless things. Any takers? :D jk

Tuesday, September 16, 2008

My Narrative for English Class :)

This is a rough draft of a narrative that I had to do for my english class in college. I liked it so much I decided to share it with yall. I don't have a title for it yet though... any ideas?


There are some things that young boys do that adults just don’t understand. I think
boys do things that are reckless because the danger makes it all the more fun. I think it’s
similar to the phenomenon of how much more funny it is to misbehave when you know
you’re not supposed to.
When I was 12, my friend Kadan and I decided it would be a
good idea to try and take out some wasp nests by throwing chunks of dirt at them. Were
there better ways to get rid of wasp nests? Yes, there were, but this was definitely one of
the more adventurous ways to do it. I don’t think we started out that morning saying to
each other, “Hey man, lets throw chunks of dirt at wasp nests and get a huge adrenaline
rush!” But as the day wore on and we got more and more bored, things kind of just fell in
place.
Kadan lived on a sort of miniature farm with goats and chickens and such, and
was surrounded by corn fields on two sides. There were several barns scattered randomly
across his property and each one of them had about a dozen wasp nests attached to it. As
we were moseying along outside wondering what we could possibly so to pass the time,
we spotted some of these wasp nests on a couple metal storage units for his family’s
tractors. “Hey,” I said excitedly, “can we get your BB guns and shoot those down?”
Kadan wasn’t too enthused about the whole idea, I think because we really weren’t
supposed to shoot at the buildings and he promptly shot my idea of a good time into a
billion pieces with a harsh, “NO!” I felt like a whipped puppy. But I wasn’t going to let
his dreary attitude dampen my spirits for long. I meandered over to the corn fields and sat
down. Kadan soon followed and sat down next to me. I think we were both pondering the
prospect of a lackluster afternoon and how neither of us wanted to live through one of
those. I reached into the dirt in the cornfield next to us and pulled out a hard chunk of
dirt. I fiddled with it for a little while, breaking pieces off and crumbling them between
my fingers. I threw a piece off into the grass where it exploded with a small puff. “Hey,”
I thought to myself, “that’s kind of groovy.” I picked up another piece and gave it a toss
with the same results. Kadan picked up on what I was doing and joined in the fun. Soon
we were seeing who could throw farther while sitting down. I would like to say I could,
but in reality I think it was a tie. I started to cheat. I stood up and let a few fly. Kadan did
the same and soon we were going crazy, letting chunks of dirt fly in all directions. It
wasn’t long before one of them hit a barn quite close to one of it’s many what seemed to
be decorative wasp nests. The wasps responded by buzzing passionately around their
abode trying to discover what had disrupted their calm lives. I looked at Kadan and we
both smiled sadistically as we rushed to get more ammunition from the corn fields. We
scooped up as many chunks as we could and rushed back to the barn where we lobbed a
continuous stream of dirt at the humble wasps who began to get very irate at our
meanness, although they couldn’t figure out it was us. We tried several different tactics to
get the best shot at the nests; direct hits, shrapnel, they were all fun and exciting and very
spectacular. We eventually knocked the nest down. We didn’t hesitate however, to locate
another nest and begin to assail it with the same barrage of weaponry and tactics we had
so skillfully employed on our last endeavor. These wasps responded with the same
frustration as the last ones, and understandably so. We laughed devilishly as each missile
exploded and the fury of the wasp’s raged on. Knocking down nest after nest never
seemed to get old until we decided to end our mission by taking out the biggest nest of
all. We thought it similar to fighting the end boss in a video game. The nest was located
inside an overhang right above a tractor tire. At first we employed the sniper method;
standing far away as we sent our projectiles sailing through the air toward our target. We
did have good aim but our weapons were not causing any damage. “That armor’s too
strong for blasters!” I said in my excitement. Unfortunately, my little joke went unnoticed
by Kadan, who had never seen Star Wars.
Soon we realized that we had to rethink our strategy for this particular “enemy
installation.” Kadan decided to implement a sneak attack approach: we would sneak
inside the building and climb on top of the tractors right tire. Standing up slowly, our plan
was to launch a huge chunk of dirt at the nest by hurling it straight up. The
get away was the fun part: after our massive bomb had exploded, we would jump down
and crouch in the corner of the building, hoping that our enemies wouldn’t detect us, and
then when the timing was right we would rush outside to safety. We had to take turns for
this tactic though… it was too dangerous to go in full force. I was a wimp I guess,
because I volunteered to go first. I sneaked inside the building and slowly scaled the
massive tire. Ammo in hand, I cautiously stood up and prepared to fire. Mustering up all
the foolishness I had in me, I let my ordnance fly. It exploded directly next to the wasps
base and sprayed it with dusty shrapnel. Kadan howled with laughter as I quickly jumped
off the tire and crouched in the dark corner. The wasps were buzzing viciously around the
nest trying to uncover the source of the disturbance. I stayed crouched in the corner and
waited for my adrenaline to tell me when to make a mad dash out of there. I ran. I didn’t
get ambushed on the way out either. Ahh, safe again, but now it was Kadan’s turn. He
went about his duty in much the same way as I had, slowly scaling the tire, only his
mission was a lot more hazardous that mine was: the wasps were already buzzing with
ferocity! I watched from what I though was a safe distance as Kadan released his bomb
into the nest. It was a direct hit and no sooner had his dirt chunk exploded than I finally
felt the wrath of an angry wasp. It dove out at me right from the nest, swooping down like
a dive bomber at an air show. The nerve of that bug! He didn’t even bother land on me,
he just swooped down with his rear end pointed right at me and stung me, stung me right
above my left eye. I hollered and ran off through a trail that lead down the corn fields. I
wasn’t wearing any shoes and some of the plants were hard and stabbed my feet but I
didn’t care, all I knew was that I got stung by one wasp and for all I knew the whole nest
was after me. I’m sure I broke a sprinting record of some kind that day, I don’t think
I’ve ever run faster. Once I thought I was far enough away I stopped running and sat
down, rubbing my eye which both itched and stung terribly at the same time. Soon
Kadan came trotting up the trail to where I was sitting. He was laughing, laughing! How
could he be laughing? Didn’t he know that I got stung? Didn’t he know that getting stung
hurt? The more I thought about it, the more I realized why he was laughing. We had been
bombarding wasp nests for an hour and a half straight, aggravating so many bugs and I
got stung; I got stung and I couldn’t take it. I felt like such a pansy. I stood up and
laughed with him. “Well I guess that’s what I get” I said.

Wednesday, September 10, 2008

6 Random Things About Me!

I suppose I have been shanghaied by Mom into writing six random thoughts about myself.

I don't think I'll follow the rules cause I am evil.

1, I often make random noises for no apparent reason just to amuse myself.

2, I have never had a girlfriend because girls think I am too weird too soon.

3, I hold two, or sometimes even three way conversations with myself on a daily basis.

4, I really don't care what's popular with people my age, I don't really want to concern myself with fitting in with everyone else. It's much more interesting to an individual rather than become just another part of some dumb trend.

5, I have the most genius revelations when I mow the lawn or use the weed-wacker. That's when I come up with the best lines and the best story ideas and it's also where I get my logic from. Unfortunately I usually forget exactly how I had imagined these things when I tell them to people and I end up butchering them.

6, I like words with double o's; poop, doom, spooky, and groovy are just a few, you doofas!

I tag... everyone has been tagged already. :(

Monday, August 25, 2008

The Continuing Adventure of Douglas R Houghton

For The Intro, Please Scroll Down 2 or 3 Posts

Douglas was born a very inquisitive child and he was constantly going exploring behind his family's home in the woods of woody areas. He was always interested in mysteries of all kinds from the Bermuda Triangle to the disappearance of Jimmy Hoffa.

When he grew up, Douglas got into science and held an extreme interest in the field of paranormal research, which ultimately lead to the adventure you will soon be told.

So, as you have already been told, Douglas was on a research vessel in the Indian Ocean when seemingly out of nowhere, a huge storm erupted and sent the craft rocking back and forth rather violently. Douglas was out on the deck at the time and was knocked unconscious by a stray oar from one of the life boats (I think life boats are still in use).
Coming to but still in a daze, Douglas looked about himself to get his bearings. The first thing he noticed was that it was not storming anymore and the sun was shining brightly on his pale skin. He was laying down in the midst of his fellow scientists who were hard at work rowing a small lifeboat through the calm water.
Doug began to struggle a bit to get up and put his hand to his head. He felt a large damp cloth on his head. He didn't know whether the cloth was moist with blood or just seawater, but it startled him nonetheless. His heart began to race and he started squirming around on the bottom of the boat. His friend Jamie put his hand on Doug's shoulder and tried to calm him down; "Doug," began Jamie, "it's OK, you just hit your head really hard, you might have brain damage but don't worry, we're not dead yet. The freaky storm is over but the research boat sank to the depths of the ocean and we can't get into contact with our fellow science team on the other boat that was supposed to be assisting us. We lost all of our equipment cause it was on the boat and we only have enough drinkable water for one day. Nobody has any clue where in this ocean we are because the sextant was lost and the GPS wasn't water proof."
Doug promptly lost consciousness once more.

Tuesday, August 19, 2008

postponed

I don't feel like writing about Douglas's adventure quite yet... I already wrote more of it down on my laptop and I don't want to rewrite it at the moment. Maybe soon the adventure will continue.

Sunday, August 10, 2008

PROGRAM!

Dear Google,

More computer programming is what we need, programming programming programming!
We need more programmers out there to program things, thingsa always need more programming. My robot needs programming every day. I think everyone should learn how to program. Get the hint?

From your non-programmer friend, Joe.

Happy programming everyone!

Saturday, August 09, 2008

Second Post of the Day! Scooter Tricks, by Ben



Two posts in one day! Scroll down to read the other one! (it's random)

Random Writing... (again)

There was a day when all seemed hopeless, but that day has finally gone away.
There was a day when all seemed lost, but now it has been found again.
I used to wallow in self pity, now I have been brought to life.
When darkness used to overtake me and I couldn't see the light.

Never again will I wander alone through the dark corridors of my deepest fears.
I now have been given a second chance and that was the answer to prayerful years.


Yeah, I just randomly wrote that in like, 1 minute... with no previous thought.

So I don't exactly know what all that means but maybe it's significant somehow... or maybe it's just a bunch of nonsensical gibberish. That's what can happen when I let my mind wander I guess.

How about a random story now? Might as well, I'm on a random roll.

The escapades of Douglas R. Houghton are as follows,
Douglas was an important member of one of the states leading science teams when it all began....

There he was out on a research vessel in the middle of the Indian ocean when suddenly, the fiercest storm erupted out of thin air and sent the craft to pitching and rolling like mad. The radio operator was desperately trying to call for help from the other research vessels in the area but he was not managing to get through to any of them. Doug was out on the deck when all of this was taking place and was occupied with trying to keep his footing when he was knocked unconscious by a stray oar from one of the lifeboats. This of course left him in quite a predicament because he could no longer concentrate on trying to keep his footing and was left to rolling along the deck at the mercy of the violent tempest.

What happened next was truly extraordinary but unfortunately I can't think of what it is at the moment and am forced (by my own will) to wait and conclude/continue the adventure on my next post. I hope I can manage to keep myself interested long enough to finish a story this time, but we will see.

Wednesday, August 06, 2008

Lesson #2

Today is cloudy... the sun is not shining... wait... yes it is. The sun is shining above the clouds.

I now have several writing projects going at once. The other day, I began to write down a very quick draft for a fantasy tale that I have been dwelling on for a year now. My problem before was that I was thinking too hard about the little piddly details that didn't matter so much and then I would lose my inspiration for the rest of the day. I learned to fill in those details with simple things that I can just go back to and work out when I am done with a quick draft. That way I won't lose inspiration for the rest of the story because the rest of the story will already be written down, HOORAY!

So, instead of spending endless hour sitting there trying to think of the most groovy name possible for your character, just call him Bob and move on. When you can't think of a good reason for your character to be out of his house, just say that he was buying some butter for the cookies he was making for his nieces birthday party and move on to more important things, like what happened to him next. After you are done writing your first draft you can come back and adjust the details as necessary.

Monday, August 04, 2008

Hooray, Another Dumb Video



Sorry Mom, I'm posting another video for you to not watch. :(

Wednesday, July 30, 2008

Unofficial Music Vids

Unofficial music videos for some song that reminded me of good stuff. I couldn't find the one I was really lokking for, but I hope you will enjoy these. :)





Saturday, July 26, 2008

Hopeful Beginnings

I have finally begun a screenplay for a story I have been writing for several months now. It only took me 1 1/2 hours to name it. It shall be called... boy don't you wish you could know that! I'm not ever telling, never never never!

But I will say that it is very groovical, with mystery, action, and more mystery and action. It is a sci-fi/fantasy epic of epic proportions, it will awe and amaze even the most hardened critic. It will inspire millions of people worldwide....

OK, on a more serious note, I have only just begun work on a screenplay and the story itself isn't yet set in stone. Screenplays usually take a couple months to finish and when they are finished you usually have to go back and rewrite them half a dozen times before you get the perfect final draft.... It takes about a year and that's when you work steadily at it.

I also have several other stories that will consume my time so this probably won't be done till I'm an old man.

I need to learn to organize my thought more in future posts, I hope this post isn't confusing :/

Wednesday, July 23, 2008

No, I Do Hate Money!

Me and My friend Joe Slocum continue our attempt to save enough pennies to purchase our first camera wich will allow us to begin production on several projects already in out heads. About two months ago, I had enough money to purchase my half of the camera but Slocum was struggling with his funds and didn't think it was wise for him to spend money on anything too expensive. Now the roles have been reversed, Slocum has plenty of funds for his half and I seem to not even have enough to pay for anything at all, much less a beautiful camera. Is this what life is all about? Struggling through each day wondering whether or not you will be able to afford the next months rent? Sometimes I wish a winning lottery ticket would get dropped at my feet but I don't think I should rely on anything like that happening in the future... I guess I'll just keep plodding along. :)

Tuesday, July 08, 2008

Tough Business

Story writing is a tough business.

Lately I have been trying to get to work on a story about... well, I can't divulge that kind of information at this time, but it is (I think) a unique idea dealing with the exploration of deep space sometime in the future. Oh the possibilities of deep space exploration are endless. The things that you can do are never ending! I will only say that I think I will call it "the Observatory."

With this particular story, I am planning to sell it to whoever or however you do that stuff. Maybe I'll get a little recognition for my concepts... maybe I am being delusional, I don't know. Maybe I need to make some friends in the entertainment business. Anybody know anyone who knows someone?

My many other concepts I would like to work really hard on and maybe take them places... maybe. I get so excited about some of them but I think I have to be careful because I am finding out that some ideas are good enough to be used in huge budget Hollywood productions, namely the climax of Indiana Jones and the Kingdom of the Crystal Skull, although I think my way was gonna be better (of course).

I hope that is easy to read and understand, sometimes I feel as if I'm just ranting.

Thursday, July 03, 2008

Hollywood prediction

Just a couple of months ago the thought went through my head "When are they going to remake the movie 'the Day the Earth Stood Still'?" The other day I learned that many of my movie predictions are coming true. Sure enough, a new one is due out later this year. Now I just have to wait and see when the movie "When Worlds Collide" will be out.

Oh, I just checked, When worlds collide, 2010. I am a genius.

Thursday, June 26, 2008

more funniness.



My favorite youtubers make funny movies.

Thursday, June 19, 2008

What is the World Coming to?

South Africa reclassifies chinese as black!

Weirdness

explanation

Below is a video of a goat licking an electric fence. I laughed pretty furiously when I first watched it on youtube and I decided to share it with all of my fans. :/

Wednesday, June 18, 2008

Monday, June 16, 2008

Lesson 1

So yeah, story writing actually takes a lot more than just writing a random story down. Sometimes that will work just fine (like this), but more often than not we need to plan out the story. This takes a lot of patience and often involves writing down all the questions and ideas that will come to your head - like this: What is Chesters occupation? Does he do private investigative work full time or just on the side? What is his relationship with Marie?

This part can often be frustrating and confusing and I have actually given up on several good story ideas as a result of getting too perplexed by these questions. I guess a trick to getting past this stage when you get frustrated is to let it alone for a few days and then come back with fresh ideas. This has proven to be a helpful technique even if it does seem like I am neglecting my work.

As for Chester and Marie, the reason that I haven't really worked on it much is probably because I figure that the story has little potential and therefore I don't really feel like I should waste my time on it. But that is stupid because I knew that when I started writing it and it's on the internet anyways so what's the problem?

Thursday, June 12, 2008

futility

Chester's mind raced furiously as he strode swiftly down the empty streets in search of something that might give him a hint at Marie's whereabouts.

Tuesday, June 10, 2008

djtcbn

I will attempt to follow up my story intro with something worthy sometime in the future... please remain calm and orderly while I attempt to dig up some original ideas, thank you for your patience.

Sunday, May 04, 2008

Stories are very fun to write. Here goes...

Intoduction

The phone rang... the phone rang again... the phone rang a third time. Chester moaned loudly when he rolled over to pick it up. He turned the light that was on his nightstand to low as he picked up the reciever.
"Hello?" he said tentatively, looking at the clock... "3:20 am" he thought to himself.
there was only silence coming from the other end. "Hello?" chester said again.
"Chester??" came a panicked voice from the other end.
"Yes? Who is this?"
" It's Marie, I'm in trouble I need your help now!"
"What's going on?" asked Chester becoming more alarmed.
There was no answer, only the sound of footprints being made rapidly. "MARIE!" he screamed loudly. Hanging up the phone and throwing on some clothes chester prepared to go out into the lonely night to search for his troubled friend. He grabbed his coat out of the closet and checked his snub nosed revolver before rushing down the flight of stairs to the front door and dissapearing into the black of night.

Monday, April 28, 2008

Yeah, so that didn't work like it was supposed to.

Name infringement.



I am not a "tipsy, knavish old villian" !



How dare they... HOW DARE THEY!!

Thursday, March 27, 2008

Writing

I want to post something new and exciting but i cant.

Oh! Lately I am attempting to go to work writing some sci-fi/fantasy-ish stories that will utterly astound and amaze even the most hardened critic. I have finished the outline for one story and have begun working on several others. It takes a lot of work really, but with a good bit of patience and a clear head (and those things can be hard to come by these days) I should be able to make some pretty interesting and unusaul stories of such uniqueness that publishing companies will be begging me to give them the honor of publishing my work. Of course I will demand a large payment up front as well as massive royalties from my works and I will be rich and powerful and I will but off the world.

Why do I always get sidetacted? This post started out serious but got goofy. Why do I allow that to happen?

Ok, so not only do I have to think of unique concepts for my stories, I also have to finish an amazing outline and then I have to fill in the blanks with dialogue and descriptions of things. It is not easy, but it may end up being fun and well worth it.

But when all is said and done, what good does it do?

Wednesday, March 19, 2008

Nothing interesting.

Today is a cloudy day. The clouds are in the sky and it is very cloudy because of that fact. The clouds are clouding up the cloudiness....

Yeah so anywho, Today I have nothing to do but sit at the library and write some blogginess. But I really can't figure out what to discuss today, so before I ruin my stellar reputation of being cool, I will end this pointless post.

Or I could rite a shourt storie.

Once upon a time, long ago and far away, there lived a little dwarf who dreamed of becoming a brave warrior. But then he lost his family inheritance in a very bad bet agaist some very bad people and was forced to live out the rest of his days in slave labor to pay off his debts and his dream never came true.

THE END

Tuesday, March 18, 2008

Interview with the Empire

Today I have a job interview at a gas station convenient store in Sodus. I think Joe Slocum may end up working there too and if we are working the same shift on the same day's that will be fun. Then we can talk and joke and make pointless conversation about nothing and when the bad guys come in to steal the money we can laugh in their faces and tackle them to the ground. I think we should enact fake robbery attempts just so that we can get it on the video surveillance cameras. After that, we can put a TV on the front counter with a sign that says "Thinking of robbing the store? Press play!" and then they will press play and it will show them all the footage of us tackling bad guys.

Yeah, that will be fun.

Monday, March 17, 2008

Hidie ho everybody!

Hidie ho everybody!

I think my life is a lesson to all of you who want to do great thing in life. Learn from me for I should know. My great prosperity does not come from family fortune, or wealthy friends, but from my own sheer will. all you need to do to achieve great renown is just act like me and the wealth you have always dreamed of having will come flowing in upon you like water out of the shower head. All you need to do is give me all of your money! AHAHAHAHAHA!!!

Friday, February 29, 2008

Woopie!

Hi everybody! How is your exsistance coming along? Mine is too boring for you to even begin to comprehend. All I do all day is lie in bed and wonder how I can make some money. Lately I have been thinking about swindling old ladies out of their meager pay. Isn't that evil? I doubt anybody will ever read this post because I have been away from cyberville for so long that I believe everybody who, in the past were my devoted fans have now gone off to seek their fortunes elswhere. Ramble ramble ramble! I am dying of fruityness! Somebody come and rescue of - I mean me. AAAHHHHHHH!!!!!

I love you Stephanie!



Woah! Sorry, I got caught up in the moment... how embarassing! (blush, blush, blush)

Tuesday, December 11, 2007

bluh

http://msn.foxsports.com/other/story/7552180?MSNHPHCP>1=10734

Friday, November 02, 2007

Monday, October 29, 2007

How Not to Elude Police



Suv's don't work to well for getaways.

Monday, July 30, 2007

So True!



Which 24 Character Are You?

You are Jack Bauer. You are an aggressive and heroic figure. You think
rules are only for kids, and try to break them at least once everyday (or
hour). You like to get help from others especially your best friends. To
complete a task, you are willing to do whatever it takes - be it the right
way or the wrong one. Also, you could totally kick Chuck Norris' rump.
Find Your Character @ BrainFall.com

I always knew it



Which Action Hero Are You?

You are MacGyver. Ingenuity is your game. Don't leave home without your sundry office supplies: rubber bands, paper clips, and the like. Life and death situations are your forte, but you may be getting too old for it. In today's eyes you're an old legend, but your first season mullet will always be remembered.
Find Your Character @ BrainFall.com

Monday, July 09, 2007

goody goody

JOE IS ALIIIIIVE!!! My blog is dying though. Here is something good though

this is good

Friday, May 04, 2007

hello

I win! I got my GED!


Now what do I do?

Saturday, April 21, 2007

Rude Dude.

Is it just me, or do all the rude drivers come out this time of year? I go around a truck parked on the side of the road and somebody coming the other direction beeps at me. I didn't even touch the center line. People don't move over to let you into traffic, they are always giving you dirty looks for no apparent reason, and even people walking on the side of the road are telling us to slow down when we're going 20 mph. Come on now, the road isn't meant for people to walk on anyway, it's meant for cars to drive on, so don't say "slow down" when you're the one walking in the road when you aren't supposed to.

All done, I feel better now.

GED (I hope)

Today I finished taking the GED test. I think I will fail. I probably got a total score of 29. Now I will have to take it all over again in like, three months. It should take from 3 to 6 weeks to get my results back.

Tuesday, April 10, 2007

Cheat

I'm the Cheat. Probably because I always cheat at everything I do.

AAAAAAAAHHHHHHHHH!!!!! HELP MEEEEEE!!!



Yeah, it had a link to the site but it's not posting properly.





Which Homestar Runner character are you?

this quiz was made by jurjyfrort

Friday, March 09, 2007

NEW POST HOORAY!!

I am all alive and am actually able to articulate. Nothing blogworthy has happened to me recently so don't be angry with me for failing to post in over a month. kdgdbliuyfdasulifdkbcdvbalgl. That is an alein language I just learned. I bet you don't know what it says.

Thursday, February 01, 2007

CELEBRATE!

My bloggie is now 50 posts old!!! I think I deserve some kind of medal for that. Or at least a promotion to... Semi-Cool Blogger status. My mom is a General in the blogger army. She's got like, 50,000,000,000 posts.

Yeah, so... now we need to throw a party and break open the keg (only kidding, I've never even seen a real keg) and General Mom can promote me in a very ceremonious ceremony. YAY!

Monday, January 22, 2007

bowSnoarding

On saturday I went snowboarding at Bristol Mountain. it was fun. Brian went too. We went on the hill and I fell down a lot. I went snowboarding only once before.

Josiah Teal -5 1/2 yrs.

Yeah. That sounds pretty good. So I'm really not very good at snowboarding yet and I did fall a lot. I have lots of aches and pains right now that keep reminding me of that. I need to go again so I can get more skilled but it isn't the cheapest hobby in the world, unfortunately.

Yeah so... that's another post.


P.S. I knocked a little kid down.

Thursday, January 18, 2007

Urgent Mission pt.1

Yeah so... this is a new post.

Recently, my friend from the CIA called and told me that he worked for the CIA and that he needed me to go to Clifford Ave. in Rochester because he had reason to believe that there was some kind of sinister plot unfolding that could put the whole world in danger. Unfortunately for him somebody overheard him tell me that he worked for the CIA and he was promptly taken to a maximum security prison in the Mojave desert. Now evidently, my friend somehow knew that I did recon and sting operations for the Delta Force when I was just a lad, and that was semi-creepy. Anywho, I went to the location he had disclosed to me (why he chose Clifford Ave. I'll never know) and located a fellow who was waiting for me. He showed me to a secret lair, underground where I was absolutely astonished to find my brother Jim typing on a computer. Now, as it turns out, my brother was evidently part of a secret organization known as the BPF or the Bad People Finders, and they had a job for me.

YAHOO!

Sunday, December 31, 2006

Poaching Redifined

On thursday, Dec. 28, Jim showed me a short movie clip from Nat. Geographic about poachers and poacher patrol and found out some startling information about the Poacher Patrol.

The clip shows the group of poacher patrollers (goodguys, right?) in South America, as they look for signs of poachers that cut down the trees. The Patrol does not want the trees to be cut down because the rain will begin to wash away the soil in the places where the trees have been taken. Eventually they hear the sound of a distant chainsaw and begin to creep up on the wicked people who cut down poor defenseless trees. Moving when the chainsaw is running (or so they think) in order to cover the sound of thier approach, the patrol finally falls upon a group of local farmers and promptly slaps hand cuffs on every one of them. One officer then hands one of them a GPS Navigator and explains to him that it is a lie detector (a lie, ironically). The farming tree poacher then has to answer the officers questions regarding the location of his rebel lumber yard and such. The heroic poacher patrollers also find out that the farmers are using the wood to build some much needed..., I think it had something to do with the storage of crops or something that the farmers really needed.
Once at the secret lumber yard, wich is filled with beautiful South American lumber, the heroic patrollers proceed to torch every square inch of lumber that they can find in the name of preserving the environment.

Does this make any sense at all?? That leaves another spot of barren land to get washed away by the rain, it also makes it so that the farmers (not poachers, that's just dumb) have to cut down more trees somewhere else and, these biologists (that's what some of these patrollers were) aren't doing much to curb "global warming" now, are they? I think they were just being jerks.

It makes me think differently about poachers. Poor, helpless poachers.

Monday, December 18, 2006

High Speed Chase on 104

On Friday Dec. 15, 2006, at approximately 4:15 pm. I was at work cooking haddock when a NYS Police Trooper pulled in the parking lot. Of course this wasn't very unusual by itself, however, Mr Trooper stepped out of his patrol car and began talking with a man in a white sedan, which was slightly more unusaul. Soon I was distracted from being distracted by the police officer, and began to focus on cooking food (a good thing I suppose). About 1 minute later Brianna came rushing in from the dining room screaming something about a car hitting a tree. I looked up and saw that the white sedan and the police car wre gone and in place of them were tire tracks leading from the parking lot and into the lawn and over a small tree. The tracks continued over the lawn and then disappeared onto 104. I knew then that there was a high speed chase underway that would most likely end in an accident. About every three minutes a police vehicle would go flying by the restaurant eastward after the vehicle. I later learned that the chase had ended about 2-3 miles from orbakers right near Reed Eye Center in sodus. From what I could gather the white car had sideswiped a couple other vehicles before flying over the edge of the road and over some nasty bumps. Joel informed me today that he learned from the Wayne County Times that the car had been stolen in webster. I still haven't been able to find any articles about it on the internet site.

THE END

Tuesday, December 05, 2006

ranting


I think it's kind of embarrassing knowing that all my stupid ranting is on the internet.

Okay, I really don't have anything to say. I am only doing this so that my blog won't die. Please don't die blog, don't die on me, I love you! Stay with me blog come on, stay awake. No, don't go to sleep, that could be bad. You might never wake up.

This is what I mean by ranting.

Well, it looks as if the librarians are turning all the computers off. Time to go.

Saturday, November 18, 2006

Any good ideas?

Hello everyone! This is a new post, isn't it exciting? I canever think of anything cool to write about. I need some inspiration. Or do you just write about how you stub your toe or bite your tongue?

Okay, so yesterday I made $37.50 in tips for delivering pizzas! Isn't that great? Oh yeah, I am getting pretty tired of my jobs. I want to do something else now. Any good ideas?

Thursday, November 09, 2006

no thing

Nothing truly postworthy has happened to me in the past few days. Nothing that I can think of anyway.

By the way, those letters in the title of that other post were all command keys (I think that's what they are called).

Thursday, October 19, 2006

yuiopasfzxcvbn

ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da
ah-da-poo-bu-da!

I did that because I forgot what to write about.

Today at work, I got yelled at for someone elses laziness in front of everyone. I hate it when that happens.

Trivia: What do all the letters in the title have in common (aside from them all being lowercase)?

Wednesday, October 11, 2006

Parts Search

My Chevy S10 LS 4x2 Pickup truck is evidently a pretty hard truck to buy parts for. All I needed for it was a bumper bar with the impact stip, and a slotted or barred grille. So far I have been to Ontario Truck Parts, the Cobbs lot in Sodus, Wilberts GM Parts in Penfield, Andy's Auto Parts in Union Hill, and the Door Store in Ontario and none of them have what I need!

Item 1, 1998 Chevy S10 LS 2WD Pickup chrome front bumper with impact strip. ($200.oo new) Item 2, 1998 Chevy S10 LS 2WD Pickup slotted/barred grille. ($125.oo new)

I almost feel as if I'm trying to get parts for a Ferarri or something.

My last stop was the Door Store and they gave me the most hope of finally getting what I need by offering to order the parts used. $140.oo for the front bumper assembly and $88.oo for the grille. I believe I will take that offer.

I do feel pretty privileged about owning such a unique piece of machinery. The LS is the second most desireable S10 pickup with the S10 extreme coming in first. My truck also has the extremely rare and super-stylish limited edition black rims. haha.

sometimes I have trouble organizing my paragraphs.

Monday, October 09, 2006

AAAAAHHHAHAAHAHAAAHAH!!!

I am completely out of blogging ideas. My blog is dying. What shall I do to saveth it?

Joe's high. Says Ben the Bold. I wisheth I knew how to posteth a video.

I beggeth every body to helpeth me to resurecteth my blog, before it's too late.

Thursday, September 21, 2006

A Story

One day, a very geeky, dorky, nerdy kid named Joe delivered a pizza to somebody's humble abode. He knocked on the door and a strange old man answered from somewhere inside. His voice was very raspy and nearly indiscernable but Joe could barely make out the words "Come on in but don't step on the rug, it's been rigged."

What happens next?? You decide. Continue my story.

Monday, September 18, 2006

blah

Oh boy, another post.

I am at the library right now and I can't think of anything exciting to say.

Tuesday, September 12, 2006

SMART!!!!!!!!!!!!!!

Blog blog blog blog blog.

cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat

That looks like DNA! (fanfare)

Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!

Now doesn't that sound like the scheme of a supersmart man to execute?

Sunday, August 27, 2006

WHY??????

Why on earth do people who drive under the speed limit always run red lights??

Sunday, August 20, 2006

Free job.

I got a pizza delivery jeaeoaeoorb. I still have my Orbahkers jorb though.

Free Post.

NEW POST!!!!!!!!!!!! Free Downloads.Free Viruses. Free spyware. free adware. Free smileys. Free games. (Popcap.com) Free Plasma TV. Free X-Box 360. Free screensavers. Free music on iTunes.com. Free bit-torrents. Free Ferrari F-50 with your purchase of any one of our great tasting soft drinks. Free DVD's. Free PDP's. Free PDVDP's. Free Superpowers, inquire within. Free vacation in the bahamas. Free dinner for two at Appledee's. Free movie tickets. Free police cruiser. Free assault weapons. Free ocean. Free ocean liner. Free dinosaur.

Friday, August 04, 2006

Key Words

Blogging again. Yes, remember that anyone can comment on my blog if they so desire.

My dear brother Jimmy said that in order to get more hits on my blog, I need to post more key-words. So I'll try it.

Ahem, Fall-out Boy. System of the Down. War of the Worlds. George W. Bush. Muhammed Ali. MIAI Abrams. Madison Square Garden. Ferrari. Groundhog Day. Ben Affleck. Stratacaster. McDonalds. Cigar Boats. Mechwarrior 2. Dell. Sasha Cohen. Sleeper Cell. Atom Bomb (yikes). Nascar. WWF. WWII. WWW. WWE. Perry's Ice Cream. Kermit the Frog. Cheeseburger. The Depesche Mode. I don't know if that's even spelled right.

That should do it!

Sunday, July 30, 2006

lost quarters

anewpostisinthemaking! Just letting everyone know that I am still alive. new posts upon this blog will fewen out from now on because I am lo nonger within easy ax-ess of a comp you ter. I do feel bad for all my zillions of devoted fans that are constantly checking my blog to see if I have posted anything that will awe and inspire millions of people worldwide. Very sorry.

Friday, July 14, 2006

groovy post

I made another new blog awhile ago. It is specifically designed for smarty pantses. Just click on the "Go Here" link on my sidebar.

Wednesday, July 12, 2006

Distressing News

I have most distressing news for everyone to hear; I have died.

Actually, I will be moving out of my lovely abode to live with my evil, wicked, dastardly, sinister, heartless, cruel, brother Dave. Here is the distressing part though; his new rented house is right next door to the Millimans house!! dun-dun-dunnn! Poor Millimans. How will they ever be able to handle me living next door to them? After all, I am a very obnoxious, noisy, pesky, stupid, emarassing-to-be-around, kid.

Hi Shelly!

Wednesday, July 05, 2006

My-Space

Ever notice how, when you browse through random blogs that 75% of them come to an abrupt end in 2004? Is this a result of My-space?

I have looked at some my-space pages and really can't figure out what makes my-space so much more coolerer than everything else.

Thoughts?

Wednesday, June 28, 2006

username

How much trouble did any of you have when picking a usename for your blog? Monday, I went and made a new blog for myself seperate from all the other blogs just so I could be somebody else. I entered in my first username wich was goodguy, then entered in my password and a fake e-mail address. Then I found out that the username was unavailable so I entered in another, wilder username. after going through the whole process of making a new blog and even posting one thing, I signed out and then went to work. At work I realiZed that I could no longer remember my username and I just spent 45 minutes this morning trying to remember it! But unfortunatel I could not remember it and I can't even delete the blog now!

Sunday, June 25, 2006

survey

Which is better, a standard, or an automatic? I like driving a standard.

Friday, June 23, 2006

New Episode of Sharkman

NEW Sharkman episode!! Click on "Stories Galories" to read.

*note; may be confusing to those whose minds are not as highly developed as mine.

Wednesday, June 21, 2006

The Neverending Sto-oreeee a-a-aa-a-a-aa-a-a-aaa

YOYOYO! My name is Joe, I live near the shores of lake Ontario!

Hey aunt Priscilla, I checked out that cool blog you told me about and I even introduced a character! Now everyone has to check it out! (I think it's PG13 though so beware) There is a link on my sidebar that says "Neverending Story." So click it and read it.

Thursday, June 15, 2006

A NEW POST!!!

I Haven't Posted Anything In Awhile Because I Haven't Really Had The Chance. i am alive though. dont worry. hopefully another cool post will appear shortly.

Thursday, June 08, 2006

New Blog

I have just made a new blog so that I can tell stupid stories and write about my day to day life without being too confusing.

Just so you know.

www.aplacetotellgoodstories.blogspot.com

Wednesday, June 07, 2006

Sharkman Returns

Alright, I have just had another inspiration for my Sharkman series (oh joy).

So lets see, last time I wrote about Sharkman I was describing all of his magnificent abilities because I could not think of anything else to write about him. Well one day, Sharkman is swimming about in the ocean in his Shark skin when all of the sudden, he smells trouble. So of course since he was a superheroe, he had to investigate. So, swimming faster that a fast boat, he finally reaches the spot that the trouble was coming from. Now I have never considered exactly how Sharkman can rescue people when he is a shark. Well, okay so lets say that he wasn't in the ocean because it's kind of inconvenient for me this time. (if you didn't read about all of sharkmans abilities this might not make much sense.) So sharkman is not a shark right now, he is dressed is his notorious Shark-Suit which doesn't limit him as much as being an actual shark does. This is probably going to be a confusing post.

So let's say that Sharkman was on vacation visiting his relatives in the town of Copper Harbor, Michigan, really quite a lovely spot. So as he was swimming around in the water having a jolly good time he happened to smell some trouble. Realizing that there was imminent danger to some poor soul out in the large lake of superiority, Hubert quickly ran to the cottage in which he was staying, donned his shark-suit, and dove into the water, leaving behind a bunch of bewildered relatives. As Hubert began to approach the spot he believed the trouble was located he began to get a weird feeling deep down in his stomach.

Well, it's almost time for me to leave now. I bet it feels like youre watching TV with my dad every time you read my blog (Dad would always watch 2 or 3 shows at once, flipping back and forth between commercials). Hopefully I'll finish this episode this time.

Tuesday, May 23, 2006

Another Rotten Story (cont.)



So anyway, about my story see...

So we left off with Xeno making up his mind to follow the band of ruthless raiders across the countryside. When at last the evil badguy captain named Aimvikedd came to town with his followers to pillage and plunder once again, Xeno just stayed hidden in the shadows (which made many of the villagers think he was a cowardly sparrow). He watched with fierce anger as his fellows and neighbors were beaten, bruised, and robbed of their income. When at last this merciless behavior was finished and Aimvikedd and his evil subordinates went galloping across the land to their hideout, Xeno emerged from his own little hideout, hopped on his trusty steed, and followed the easy-to-find tracks that were left by the bad guys. Now I want to name Xeno's horse. How about... Agutwahn.

You know, now I know why authors take a chapter in the beginning of a book to explain things. It makes for boring reading at first but in the long run, it's much more helpful.
Okay, Xeno was of muscular build (of course all heroes need that) and he had dark brown hair that was slightly wavy and went down to his shoulders. His eyes were darkly colored. He carried a battle sword at his right side and a smaller katana type knife-sword thing under his cloak on the same side (for he was left-handed) and a quiver of arrows slung across his back. Unfortunately for him he had no bow at this time for in his hurry to hide from the evildoers, he had dropped it on the ground. A bow in the hands of the villagers and peasants of course, was outlawed. So they had taken it away and yelled and screamed at everyone for they were desperate to know who it had belonged to. But of course the villagers would never give away their only hope for deliverance out of bondage from the raiders. Lets see..., oh yes, there was a lovely young peasant girl that he loved and wished to marry someday whose name was Marian.

Okay, that's good for now.

So he took off after the wicks and followed at a distance for days and nights. The local law enforcement at Xeno's hometown were furious with him and decided to take off after him so they could "stop him from getting hurt."

Then one afternoon, Xeno spotted Ye Olde Forest off in the distance. But then the Law enforcement officials overtook him. "Hail Xeno, keeper of the peace!" Xeno had never been called a keeper of the peace before and this quite flattered him.
"Hail Law enforcement, enforcers of the law!" Xeno replied.
"We have overtaken thee to bid thee not to enter Ye Olde Forest for thy life shall be in grave peril."
"Sires, it is my duty as a citizen of an oppressed village to attempt to liberate thee out of bondage from ye evil oppressors."
"KEEP SILENT!!" the head officer barked. "I shall tell thee what is thy duty as a citizen of my village!"
"Then pray, what is my duty?"
"Thy duty shall be to keep thy opinions to thyself just as thy fellow kinsmen hath done for an age, and to never esteem thyself as in the position to take any unneeded action against thy oppressors."
"Thou hast spoken falsely, to liberate a nation is a great duty to be performed by not only those who are oppressed, but also by those that are observing the oppression of that nation." (political agenda)

Oh no, will Xeno be able to continue his quest to liberate his village? Or will he have to be escorted back across the country by the officers? The only way to find out is... keep reading my posts. So Long For now. Peace out!!

Monday, May 22, 2006

Another Rotten Story

"Put a sock in it" he says. What a guy. I have ten minutes to come up whiththtjh a good story.

One day long ago in the kingdom of Werbahdguiz, ther lived some very bad guys. They would raid the local villages of all their riches and make off into the woods where their secret fortress was hidden in the shadows. The local athorities were strangely ignorant of these unfortunate occurances and did little to help the poor townsfolk. Then one day there arose among the peasants, a hero named Xeno. Xeno decided to follow the ruthless band of raiders across the countryside and into the dreaded forest of doom.

OH PHOOEY!! ten minutes isare up already! Well Mom, don't try to give me any ideas for this story because I already have it all figured out and I don't want you to give any of it away. (I'll love you even if you can't resist though.) until nextime, I'm Joe Fool saying so long for now.

Saturday, May 13, 2006

Friday, May 12, 2006

Lack of Wisdom


Today I had half my wisdom surgically removed. So now I can't figure out why Mom put that picture right there and named this post "Lack of Wisdom". This picture must represent some kind of reaction to something dumb I said because of the fact that I now have the brains of a nine year old (no offense to any nine year olds that may happen to stumble upon my blog). But my jaw is feeling as if it has two gaping holes in it now! It really is quite strange all the odd thoughts that go through my mind when I'm inhaling nitrous. Like, for instance, "Why don't I just study Dr. Berger's beard since I have nothing better to do?" It really was quite an interesting beard with all it's strange coloration (black and grey) and all the precise distances between the whiskers. Enough of that for now I guess.

Friday, May 05, 2006

A Piratee Story (cont.)

After examining his helpless situation, Henry decides that the only thing to do is outsmart these vicious brutes with his infinitely superior intellect. Unfortunately he cannot think of any way to do this for all the island natives speak cannibalian and Henry doesn't know that language. Neither can he use his handy dandy boom-boom stick for it is currently lying on the bottom of the Pacific ocean. And I am currently having a hard time coming up with some spectacular escape plan for him to execute.

I guess I should start by explaining the circumstances surrounding his capture. Well, it went like this; as a fierce native was strolling along the beach one day looking for perdy sea-shells to decorate his hut with, he chanced to come across an odd piece of wood lying on the sand. After inspecting his find very carefully, he decided it was some kind of unusual weapon, and, being the kind of good natured native that he was went to see if he could find any more for his buddy. And that was how he happened to come across a most unusual specimen. Mr. Native was so excited at his unique find that he ran to the willage as fast as his to legs could carry him to bring news of his discovery to all the town board. They of course were very excited to hear about the strange weapon he had found but more importantly they wanted to know about his second discovery. After listening to Native #1 (lets call him Paco) tell his fascinating story, they all voted on whether or not to send out a group of militia to extract Henry from the beach. Following much deliberation, they agreed to dispatch a group of highly trained recon soldiers to execute their bold plan. Paco went along to see all the excitement happen. When the unit of recon soldiers got to the beach they were all flabbergasted, "Paco not joke." one soldier stated.Another pulled out a length of hemp and quickly bound the wicked man up with it. Then they all (excluding Paco) hoisted Henry's limp body up above their heads and danced off into the foliage with Paco following close behind. As soon as they got back into town, every living soul there was aghast. They had never seen such an unusual thing before. After determining that he was still in good health, the mayor decided that, since they were low on food, they would fatten him up and eat him for thanksgiving. (how horrid!) Then he awoke and sent the whole village into a panic for no apparent reason. And that is where we find him.

I still have to try and figure out how he makes his daring escape, so stay tuned for more adventures of... Henry the Cut-throat Pirate.

Thursday, May 04, 2006

A Piratee Story

Once upon a time, in the oceans of the south pacific, there lived a dastardly wicked pirate named Henry. Henry was feared by all men, dead and alive and he was nearly invincible. He had the bestest of ships and an extraordinarily evil crew. He would often go out pillaging and plundering upon the high seas and send stark terror into the hearts of sharks everywhere.
Anyway, one day Henry's ship ran into rocks in a fierce storm and sank to the depths of the sea drowning every one of his crewmembers. Henry was the sole survivor of the terrible wreckage and was left to be tossed to and fro on the violent waves with nothing but a large chunk of spalted maple to keep him afloat. After drifting for days out in the middle of no-mans-land, Henry spotted land. But if you think that he could just swim to shore like nothing after drifting around helplessly for days with no food or good water you should work in hollywood. He had to wait till the current pulled him closer to shore before he even considered making a swim for it. It was a long and arjuous swim for him and when he finally got to shore he dragged himself up high enough so that the tide wouldn't get him and fell fast asleep. When he awoke, he was surrounded by angry natives who looked frighteningly hungry. Carefully examining the situation, Henry thought up a bold plan.

END OF PART ONE. PLEASE FLIP TAPE OVER TO HEAR PART TWO.
or just wait till I think up a bold plan for Henry to execute

Wednesday, May 03, 2006

A Few Good Stories

I am afeared that sharkman may die. I can't seem to come up with any good ideas.

Once upon a time, there was a lowly peasant whose house got burninated by a big, mean dragon named Trogband. So the peasant swore revenge upon the dragon and set out upon a fateful quest to kill him. Then peasantman got the supertrinket and used it to buy his way into the archery bow winning contest and of course he won with great ease and then he killed the Ogre and fell in a mud puddle and got his good shirt all dirty and then it's all over the end.

Once upon another time there was a little boy who wished for a better life. But unfortunately, his wish was never granted, THE END.

One day, the good king went out upon the balcony-thing to survey his kingdom. Suddenly, from out of nowhere came a big fat ugly... *GASP*... PIZZA DELIVERY GUY!!

One day a man met his doom the end.

Once while I was being dumb, I got hurt.

This is the story of a courageous young warrior named Xeno. He charged the ranks of the goblins of Mount Gram in the battle of the green fields, and knocked their king golfimbuls head clean off with a wooden club. It sailed a hundred yards through the air and went down a rabbit hole. And in this way the battle was won and the game of golf invented in the same moment.

Now that I have completely exhausted all my story-telling abilities, I must beg of you to help me come up with more lovely stories such as these that I have just told you. All your ideas are welcome... maybe.

Tuesday, April 25, 2006

A Story with a Moral

Once upon a time in the fair kingdom of braunmont, there lived a lowly pheasant. Then the pheasant got shot by a peasant. Then the peasant (we'll call him Ed) robbed the mighty king of all his wealth and made off into the woods were he was promptly eaten by savage mosquitoes. Proving once and for all that you shouldn't steal. You can probably tell that I have no clue what to write about, and the Sharkman story hasn't had any more inspirations so far. But keep looking, I'm bound to have some interesting story to tell someday. Ideas anyone?

Monday, April 24, 2006

I have a stupid brother his name is ben. I have to go to work now.

Friday, April 21, 2006

Sharkman Tries to Continue

From this point I am a bit confused as to where I should go next with this Sharkman thing. I guess that I'll try hard to make all you Sharkman fans happy!

Last time on Sharkman:( We learned that as Hubert was having a swim in shark infested water near a nuclear power plant he was chomped by a big shark and then he turned into a shark himself... Yeah.... Now for:) Sharkman Returns (although I didn't know that he had left)

I guess I really don't have any ideas after all. Oh, but I must discuss his superness more completely. Ok, first of all he only turned into a shark when he was in salt water (He was a shark on the beach before because his swim trunks were wet) but whenever he wanted to be a shark in freshwater he was distraught, for he could not turn into a shark then. (Boy this is a strange story!) But it was this unfortunate occurrence (or "unoccurrence") that lead to the construction of his notorious shark suit which struck sheer terror into the hearts of evildoers everywhere. Other than the unnatural ability to turn into a shark, Hubert also got a slew of other abnormal qualities about himself that I will list here.

The Superswim: This was the power to swim very vast even when he wasn't a shark.

The Superchomp: This power came in real good handy when he went out to fancy restaurants like Applebee's and ordered a piece of steak.

The Watersniff: The ability to smell trouble in the water from two miles away.

The Iron torso: A very strong torso (which, by the way, no good superhero can go without).

And Finally, The Sharktongue: This allowed him to converse with any shark he pleased (which came in handy dandy later on).

Tuesday, April 18, 2006

Sharkman Begins

No, it is not haddock day anymore. But it is the first time in quite awhile that I have had a chance to get on the blogger. But, it seems that I have all kinds of fantastic ideas of things to blog about but I always forget them when I get on the computer. Perhaps I shall tell you a story about the menny avencherz uv... SHARKMANN!! Dananananananananananananananana SHARKMANN!!!! Oh deere, I'm drawing a blank.
Once upon a time there lived a man who loved to swim. One day... Hubert (that was his name I guess) decided to go for a swim near a nuclear power plant. Don't ask me why he decided to do that because I really have no clue. But it just so happened that there was a rather large and sinister looking shark swimming near the same power plant on that very same day who promptly bit Huey's pinkey fingers off and swam away laughing. Now Huey was not the excitable sort and, examining the situation carefully, decided that the best thing to do was to get out of the water (a logical idea in my opinion). So Hubert swim for shore and save himself and, feeling a bit drowsy, decided to drive home and take a nap. unfortunately for him his car had mystyriously fallen off a large cliff and exploded. Deciding at last that there was nothing better to do he lew himself down and dozed off right on the beach. when he awoke, he had a strange inclination to go for another swim and, feeling nothing better to do (which, quite often in Hueys life there was nothing better to do) began to try and get up. But for some reason beyond his guessing, try as he might he could not manage to get himself up. But he soon discovered that rolling himself over and over was not only for children but for him too (at least it was at this point in time). The water was looking ever so good to him at the moment and for the life of him he couldn't figure out why (He also greatly desired a tuna fish sandwich). He was much relieved when, at last he splished into the water. He somehow found the water unusually comfortable and began swimming around. And in this way, Hubert learned that, over the period in which he was peacefully sleeping, he was also peacefully turning into a shark.

Wednesday, April 05, 2006

Haddock day

Howdy howdy howdy! I cant think of anything groovy to write about today. Oh yeah, today is haddock cleaning day at work so I must be very prepared to clean 65 libras of foosh, or feesh, or fash, or is it foshes. It is usually a lot of fun because me and Joel whisper and laugh at random foolishness and then danielle gets very cranky because she always thinks that we are laughing at her. We really only very rarely ever laughed at her and I don't think that we actually have in quite some time now so she really has no need to get so distraught over the whole thing. Although one time I did march up to her one time with a wet, cold, slimy fish in my hand and slapped her in the face with it, which of course made everybody laugh uproariously except for Danielle. Her face has dripping and had pieces of raw haddock all over it. Okay, so that part dinnit really happen.

Monday, March 27, 2006

Jumbled thoughts on my trip to Mississippi.

Todasy iejnhvklshoifvkjblnsedy... Today is my first full day back at home. As you may have seen I spent the last nine days out of town. I went with a group of guys from CCW, CCFL, and CCN (Calvary Chapel Webster, Finger Lakes, and Newark) to Mississippi to help people fix their houses. Can you understand what I just wrote?? Oh well. Anyhow, we all had a blessid time and I cant write good today and I don't know why. ahahahahahahahahahahaaaaaaaaaaaaaaaaaaa!!! But I did make some groovy new friends like Joseph Frascatore, and his daddy Tom, And George "Humble" Humby, and... oh it would take a while to go through all of the groovy dudes that went. But it was a fun time.

Monday, March 20, 2006

The Imposter

Joe can't be here today. He is not home. He went on a long trip. He is in Biloxi, Mississippi. That is all for today.

Tuesday, March 14, 2006

Tuesdays

"Porridge today Gromit, Tuesday." Nate just made himself some oatmeal for breakfast but he dinnit make any for anyone else! "I think I'll get my own porridge." Maybe I should just make some yummy eggses! Or some crunchable birdses! Mmmm, juicy sweet. Haha, I am such a doofas.
Today is, as I said, Tuesday, and I very strongly dislike working on Tuesdays because I work with a bunch of girls that like to tell me how everything is done and how I always burn stuff which is not true (not that I can remember anyway). They always seem very ready to boss me around all day while they stand around and chit-chat like women do. "Joe, I dont want to do that job so you can do it, and when your done you can do all those other jobs that I hate. I'll just stand here and talk about all the troubles in my life." Then I have to train Nancy on the fryer which is really quite hopeless because she never listens to anything I tell her. She's always giving the customer vegetable oil sandwiches and stuff like that. Yes, Working at Orbakers on a Tuesday when I am the only Guy there during the day is quite an endeavor.

Wednesday, March 08, 2006

Killer Looks


Here is a self portrait of myself. As you can see I am quite a handsome fellow. Maybe I should go into the acting business. I am sure that they would give me the main role in any film I wished to star in, from "Indiana Smith" to "the Life and Trials of a Marine Biologist". Don't you Agree?

Tuesday, March 07, 2006

Sorry Brian

Today is tuesday, March... 7th? Any way, on saturday me and my friend Brian went to Brantling hill in Sodus to go snowboarding ( oh yeah, his sister Heather went too, LOL). It was quite frusterating for me at first becuase every time I tried to turn I fell on my bum. Brian tried to encourage me by saying that that stuff always happens and to just stick with it. And me, being all flummoxed, would always respond to him kind of sharply (not to be rude but just cause I was irratated and embarrassed at falling down on the bunny hill. So I think I made Brian mad at me for that but I really didn't mean to.
And then at about 3:30 PM I fell backwards after hitting a little bump and hit my head and got a head-ache and then I dinnit feel like snowboarding any more but Brian did and he got all dissappointed... Grrr. Maybe I'll go agian sometime and do better and not get so irratated and hurt my good friends feelings. Sorry Brian.

Friday, February 17, 2006

my life story

I am getting tired of cooking french fries for six hours a day. I want to do something else with my life now. I'm sure that there are millions of kids who feel the same way. If I was making $8 an hour like all the other cooks there I wouldnt mind so much but I make miminum wage, wich I guess is better than nothing.

Thursday, February 16, 2006

Of the US Military

Today I would Like to let everyone be aware that I am considering joining either the Army or the Army National guard. Yes weep for me, lift up your voice and lament for my time has come to leave this wretched place and become who I was born to be!

But really, why is it that whenever I mention to somebody that I may join the U.S. military, they try to convince me not to? They say stuff like, "No I don't want you to get shot", and "You're too smart for the military". I may be too smart for the military I guess (haha) but... then again, maybe they need some edumicated... WAIT A MINUTE!! To everyone who thinks that the military is made up of stupid kids who couldn't get any other job I advise you to think again. The U.S. military is chok full of highly intelligent kids from all over the country.

I have to go to work now. Bye bye

Monday, February 13, 2006

I Dont Know What to Write

For the first time in... awhile I get to post something! Now, what should I post?
How about I post an essay that I have written. Tell me what you think.


Dear Editor,


I am absolutely disgusted at the December 5 editorial which stated that there are no military heroes. What an unpatriotic thing to say! U.S. Soldiers are daily putting their lives on the line to defend our country and we thank them by saying “there are no military heroes”?? That sickens me!
And saying that our military personnel are trained “shoddily” is a direct insult to all of our armed forces. I personally know three marines and I can assure you, they are not trained “shoddily.”
Also, before being too quick in saying that we are the aggressor in this war, remember September 11 (an event to which we all said “we will never forget”), and remember also, the U.S.S. Cole. We are not the aggressor.
One more thing, liberating millions of people from the grasp of a ruthless mass murderer is not what I call “morally wrong.” I honestly can’t understand why some people insist on lowering our troop’s morale.
Remember, greater love has no man than he who lays down his life for his friend.



Sincerely,



Josiah Teal


That one actually got published in the Rochester Democrat & Chronicle on Dec. 18, 2005. I was so pleased (although it did get edited by the editor).