Blog blog blog blog blog.
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
Subscribe to:
Post Comments (Atom)
4 comments:
dumb, dumb, dumb, dumb, dumb! dumb, dumb, dumb, dumb.
Hello! Your weird! Maybe someday you'll win an oscar. Does this look like DNA? joejoejoeeojjoeooejJOE
I can't hear you - all I can hear is creamed corn.
Run home, Joe, run home!
Post a Comment