Hello everyone! This is a new post, isn't it exciting? I canever think of anything cool to write about. I need some inspiration. Or do you just write about how you stub your toe or bite your tongue?
Okay, so yesterday I made $37.50 in tips for delivering pizzas! Isn't that great? Oh yeah, I am getting pretty tired of my jobs. I want to do something else now. Any good ideas?
Saturday, November 18, 2006
Thursday, November 09, 2006
no thing
Nothing truly postworthy has happened to me in the past few days. Nothing that I can think of anyway.
By the way, those letters in the title of that other post were all command keys (I think that's what they are called).
By the way, those letters in the title of that other post were all command keys (I think that's what they are called).
Thursday, October 19, 2006
yuiopasfzxcvbn
ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da
ah-da-poo-bu-da!
I did that because I forgot what to write about.
Today at work, I got yelled at for someone elses laziness in front of everyone. I hate it when that happens.
Trivia: What do all the letters in the title have in common (aside from them all being lowercase)?
ah-da-poo-bu-da!
I did that because I forgot what to write about.
Today at work, I got yelled at for someone elses laziness in front of everyone. I hate it when that happens.
Trivia: What do all the letters in the title have in common (aside from them all being lowercase)?
Wednesday, October 11, 2006
Parts Search
My Chevy S10 LS 4x2 Pickup truck is evidently a pretty hard truck to buy parts for. All I needed for it was a bumper bar with the impact stip, and a slotted or barred grille. So far I have been to Ontario Truck Parts, the Cobbs lot in Sodus, Wilberts GM Parts in Penfield, Andy's Auto Parts in Union Hill, and the Door Store in Ontario and none of them have what I need!
Item 1, 1998 Chevy S10 LS 2WD Pickup chrome front bumper with impact strip. ($200.oo new) Item 2, 1998 Chevy S10 LS 2WD Pickup slotted/barred grille. ($125.oo new)
I almost feel as if I'm trying to get parts for a Ferarri or something.
My last stop was the Door Store and they gave me the most hope of finally getting what I need by offering to order the parts used. $140.oo for the front bumper assembly and $88.oo for the grille. I believe I will take that offer.
I do feel pretty privileged about owning such a unique piece of machinery. The LS is the second most desireable S10 pickup with the S10 extreme coming in first. My truck also has the extremely rare and super-stylish limited edition black rims. haha.
sometimes I have trouble organizing my paragraphs.
Item 1, 1998 Chevy S10 LS 2WD Pickup chrome front bumper with impact strip. ($200.oo new) Item 2, 1998 Chevy S10 LS 2WD Pickup slotted/barred grille. ($125.oo new)
I almost feel as if I'm trying to get parts for a Ferarri or something.
My last stop was the Door Store and they gave me the most hope of finally getting what I need by offering to order the parts used. $140.oo for the front bumper assembly and $88.oo for the grille. I believe I will take that offer.
I do feel pretty privileged about owning such a unique piece of machinery. The LS is the second most desireable S10 pickup with the S10 extreme coming in first. My truck also has the extremely rare and super-stylish limited edition black rims. haha.
sometimes I have trouble organizing my paragraphs.
Monday, October 09, 2006
AAAAAHHHAHAAHAHAAAHAH!!!
I am completely out of blogging ideas. My blog is dying. What shall I do to saveth it?
Joe's high. Says Ben the Bold. I wisheth I knew how to posteth a video.
I beggeth every body to helpeth me to resurecteth my blog, before it's too late.
Joe's high. Says Ben the Bold. I wisheth I knew how to posteth a video.
I beggeth every body to helpeth me to resurecteth my blog, before it's too late.
Thursday, September 21, 2006
A Story
One day, a very geeky, dorky, nerdy kid named Joe delivered a pizza to somebody's humble abode. He knocked on the door and a strange old man answered from somewhere inside. His voice was very raspy and nearly indiscernable but Joe could barely make out the words "Come on in but don't step on the rug, it's been rigged."
What happens next?? You decide. Continue my story.
What happens next?? You decide. Continue my story.
Monday, September 18, 2006
blah
Oh boy, another post.
I am at the library right now and I can't think of anything exciting to say.
I am at the library right now and I can't think of anything exciting to say.
Tuesday, September 12, 2006
SMART!!!!!!!!!!!!!!
Blog blog blog blog blog.
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
Sunday, August 27, 2006
Sunday, August 20, 2006
Free Post.
NEW POST!!!!!!!!!!!! Free Downloads.Free Viruses. Free spyware. free adware. Free smileys. Free games. (Popcap.com) Free Plasma TV. Free X-Box 360. Free screensavers. Free music on iTunes.com. Free bit-torrents. Free Ferrari F-50 with your purchase of any one of our great tasting soft drinks. Free DVD's. Free PDP's. Free PDVDP's. Free Superpowers, inquire within. Free vacation in the bahamas. Free dinner for two at Appledee's. Free movie tickets. Free police cruiser. Free assault weapons. Free ocean. Free ocean liner. Free dinosaur.
Friday, August 04, 2006
Key Words
Blogging again. Yes, remember that anyone can comment on my blog if they so desire.
My dear brother Jimmy said that in order to get more hits on my blog, I need to post more key-words. So I'll try it.
Ahem, Fall-out Boy. System of the Down. War of the Worlds. George W. Bush. Muhammed Ali. MIAI Abrams. Madison Square Garden. Ferrari. Groundhog Day. Ben Affleck. Stratacaster. McDonalds. Cigar Boats. Mechwarrior 2. Dell. Sasha Cohen. Sleeper Cell. Atom Bomb (yikes). Nascar. WWF. WWII. WWW. WWE. Perry's Ice Cream. Kermit the Frog. Cheeseburger. The Depesche Mode. I don't know if that's even spelled right.
That should do it!
My dear brother Jimmy said that in order to get more hits on my blog, I need to post more key-words. So I'll try it.
Ahem, Fall-out Boy. System of the Down. War of the Worlds. George W. Bush. Muhammed Ali. MIAI Abrams. Madison Square Garden. Ferrari. Groundhog Day. Ben Affleck. Stratacaster. McDonalds. Cigar Boats. Mechwarrior 2. Dell. Sasha Cohen. Sleeper Cell. Atom Bomb (yikes). Nascar. WWF. WWII. WWW. WWE. Perry's Ice Cream. Kermit the Frog. Cheeseburger. The Depesche Mode. I don't know if that's even spelled right.
That should do it!
Sunday, July 30, 2006
lost quarters
anewpostisinthemaking! Just letting everyone know that I am still alive. new posts upon this blog will fewen out from now on because I am lo nonger within easy ax-ess of a comp you ter. I do feel bad for all my zillions of devoted fans that are constantly checking my blog to see if I have posted anything that will awe and inspire millions of people worldwide. Very sorry.
Friday, July 14, 2006
groovy post
I made another new blog awhile ago. It is specifically designed for smarty pantses. Just click on the "Go Here" link on my sidebar.
Wednesday, July 12, 2006
Distressing News
I have most distressing news for everyone to hear; I have died.
Actually, I will be moving out of my lovely abode to live with my evil, wicked, dastardly, sinister, heartless, cruel, brother Dave. Here is the distressing part though; his new rented house is right next door to the Millimans house!! dun-dun-dunnn! Poor Millimans. How will they ever be able to handle me living next door to them? After all, I am a very obnoxious, noisy, pesky, stupid, emarassing-to-be-around, kid.
Hi Shelly!
Actually, I will be moving out of my lovely abode to live with my evil, wicked, dastardly, sinister, heartless, cruel, brother Dave. Here is the distressing part though; his new rented house is right next door to the Millimans house!! dun-dun-dunnn! Poor Millimans. How will they ever be able to handle me living next door to them? After all, I am a very obnoxious, noisy, pesky, stupid, emarassing-to-be-around, kid.
Hi Shelly!
Wednesday, July 05, 2006
My-Space
Ever notice how, when you browse through random blogs that 75% of them come to an abrupt end in 2004? Is this a result of My-space?
I have looked at some my-space pages and really can't figure out what makes my-space so much more coolerer than everything else.
Thoughts?
I have looked at some my-space pages and really can't figure out what makes my-space so much more coolerer than everything else.
Thoughts?
Wednesday, June 28, 2006
username
How much trouble did any of you have when picking a usename for your blog? Monday, I went and made a new blog for myself seperate from all the other blogs just so I could be somebody else. I entered in my first username wich was goodguy, then entered in my password and a fake e-mail address. Then I found out that the username was unavailable so I entered in another, wilder username. after going through the whole process of making a new blog and even posting one thing, I signed out and then went to work. At work I realiZed that I could no longer remember my username and I just spent 45 minutes this morning trying to remember it! But unfortunatel I could not remember it and I can't even delete the blog now!
Sunday, June 25, 2006
Friday, June 23, 2006
New Episode of Sharkman
NEW Sharkman episode!! Click on "Stories Galories" to read.
*note; may be confusing to those whose minds are not as highly developed as mine.
*note; may be confusing to those whose minds are not as highly developed as mine.
Wednesday, June 21, 2006
The Neverending Sto-oreeee a-a-aa-a-a-aa-a-a-aaa
YOYOYO! My name is Joe, I live near the shores of lake Ontario!
Hey aunt Priscilla, I checked out that cool blog you told me about and I even introduced a character! Now everyone has to check it out! (I think it's PG13 though so beware) There is a link on my sidebar that says "Neverending Story." So click it and read it.
Hey aunt Priscilla, I checked out that cool blog you told me about and I even introduced a character! Now everyone has to check it out! (I think it's PG13 though so beware) There is a link on my sidebar that says "Neverending Story." So click it and read it.
Subscribe to:
Posts (Atom)
