Sunday, December 31, 2006

Poaching Redifined

On thursday, Dec. 28, Jim showed me a short movie clip from Nat. Geographic about poachers and poacher patrol and found out some startling information about the Poacher Patrol.

The clip shows the group of poacher patrollers (goodguys, right?) in South America, as they look for signs of poachers that cut down the trees. The Patrol does not want the trees to be cut down because the rain will begin to wash away the soil in the places where the trees have been taken. Eventually they hear the sound of a distant chainsaw and begin to creep up on the wicked people who cut down poor defenseless trees. Moving when the chainsaw is running (or so they think) in order to cover the sound of thier approach, the patrol finally falls upon a group of local farmers and promptly slaps hand cuffs on every one of them. One officer then hands one of them a GPS Navigator and explains to him that it is a lie detector (a lie, ironically). The farming tree poacher then has to answer the officers questions regarding the location of his rebel lumber yard and such. The heroic poacher patrollers also find out that the farmers are using the wood to build some much needed..., I think it had something to do with the storage of crops or something that the farmers really needed.
Once at the secret lumber yard, wich is filled with beautiful South American lumber, the heroic patrollers proceed to torch every square inch of lumber that they can find in the name of preserving the environment.

Does this make any sense at all?? That leaves another spot of barren land to get washed away by the rain, it also makes it so that the farmers (not poachers, that's just dumb) have to cut down more trees somewhere else and, these biologists (that's what some of these patrollers were) aren't doing much to curb "global warming" now, are they? I think they were just being jerks.

It makes me think differently about poachers. Poor, helpless poachers.

Monday, December 18, 2006

High Speed Chase on 104

On Friday Dec. 15, 2006, at approximately 4:15 pm. I was at work cooking haddock when a NYS Police Trooper pulled in the parking lot. Of course this wasn't very unusual by itself, however, Mr Trooper stepped out of his patrol car and began talking with a man in a white sedan, which was slightly more unusaul. Soon I was distracted from being distracted by the police officer, and began to focus on cooking food (a good thing I suppose). About 1 minute later Brianna came rushing in from the dining room screaming something about a car hitting a tree. I looked up and saw that the white sedan and the police car wre gone and in place of them were tire tracks leading from the parking lot and into the lawn and over a small tree. The tracks continued over the lawn and then disappeared onto 104. I knew then that there was a high speed chase underway that would most likely end in an accident. About every three minutes a police vehicle would go flying by the restaurant eastward after the vehicle. I later learned that the chase had ended about 2-3 miles from orbakers right near Reed Eye Center in sodus. From what I could gather the white car had sideswiped a couple other vehicles before flying over the edge of the road and over some nasty bumps. Joel informed me today that he learned from the Wayne County Times that the car had been stolen in webster. I still haven't been able to find any articles about it on the internet site.

THE END

Tuesday, December 05, 2006

ranting


I think it's kind of embarrassing knowing that all my stupid ranting is on the internet.

Okay, I really don't have anything to say. I am only doing this so that my blog won't die. Please don't die blog, don't die on me, I love you! Stay with me blog come on, stay awake. No, don't go to sleep, that could be bad. You might never wake up.

This is what I mean by ranting.

Well, it looks as if the librarians are turning all the computers off. Time to go.

Saturday, November 18, 2006

Any good ideas?

Hello everyone! This is a new post, isn't it exciting? I canever think of anything cool to write about. I need some inspiration. Or do you just write about how you stub your toe or bite your tongue?

Okay, so yesterday I made $37.50 in tips for delivering pizzas! Isn't that great? Oh yeah, I am getting pretty tired of my jobs. I want to do something else now. Any good ideas?

Thursday, November 09, 2006

no thing

Nothing truly postworthy has happened to me in the past few days. Nothing that I can think of anyway.

By the way, those letters in the title of that other post were all command keys (I think that's what they are called).

Thursday, October 19, 2006

yuiopasfzxcvbn

ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da
ah-da-poo-bu-da!

I did that because I forgot what to write about.

Today at work, I got yelled at for someone elses laziness in front of everyone. I hate it when that happens.

Trivia: What do all the letters in the title have in common (aside from them all being lowercase)?

Wednesday, October 11, 2006

Parts Search

My Chevy S10 LS 4x2 Pickup truck is evidently a pretty hard truck to buy parts for. All I needed for it was a bumper bar with the impact stip, and a slotted or barred grille. So far I have been to Ontario Truck Parts, the Cobbs lot in Sodus, Wilberts GM Parts in Penfield, Andy's Auto Parts in Union Hill, and the Door Store in Ontario and none of them have what I need!

Item 1, 1998 Chevy S10 LS 2WD Pickup chrome front bumper with impact strip. ($200.oo new) Item 2, 1998 Chevy S10 LS 2WD Pickup slotted/barred grille. ($125.oo new)

I almost feel as if I'm trying to get parts for a Ferarri or something.

My last stop was the Door Store and they gave me the most hope of finally getting what I need by offering to order the parts used. $140.oo for the front bumper assembly and $88.oo for the grille. I believe I will take that offer.

I do feel pretty privileged about owning such a unique piece of machinery. The LS is the second most desireable S10 pickup with the S10 extreme coming in first. My truck also has the extremely rare and super-stylish limited edition black rims. haha.

sometimes I have trouble organizing my paragraphs.

Monday, October 09, 2006

AAAAAHHHAHAAHAHAAAHAH!!!

I am completely out of blogging ideas. My blog is dying. What shall I do to saveth it?

Joe's high. Says Ben the Bold. I wisheth I knew how to posteth a video.

I beggeth every body to helpeth me to resurecteth my blog, before it's too late.

Thursday, September 21, 2006

A Story

One day, a very geeky, dorky, nerdy kid named Joe delivered a pizza to somebody's humble abode. He knocked on the door and a strange old man answered from somewhere inside. His voice was very raspy and nearly indiscernable but Joe could barely make out the words "Come on in but don't step on the rug, it's been rigged."

What happens next?? You decide. Continue my story.

Monday, September 18, 2006

blah

Oh boy, another post.

I am at the library right now and I can't think of anything exciting to say.

Tuesday, September 12, 2006

SMART!!!!!!!!!!!!!!

Blog blog blog blog blog.

cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat

That looks like DNA! (fanfare)

Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!

Now doesn't that sound like the scheme of a supersmart man to execute?

Sunday, August 27, 2006

WHY??????

Why on earth do people who drive under the speed limit always run red lights??

Sunday, August 20, 2006

Free job.

I got a pizza delivery jeaeoaeoorb. I still have my Orbahkers jorb though.

Free Post.

NEW POST!!!!!!!!!!!! Free Downloads.Free Viruses. Free spyware. free adware. Free smileys. Free games. (Popcap.com) Free Plasma TV. Free X-Box 360. Free screensavers. Free music on iTunes.com. Free bit-torrents. Free Ferrari F-50 with your purchase of any one of our great tasting soft drinks. Free DVD's. Free PDP's. Free PDVDP's. Free Superpowers, inquire within. Free vacation in the bahamas. Free dinner for two at Appledee's. Free movie tickets. Free police cruiser. Free assault weapons. Free ocean. Free ocean liner. Free dinosaur.

Friday, August 04, 2006

Key Words

Blogging again. Yes, remember that anyone can comment on my blog if they so desire.

My dear brother Jimmy said that in order to get more hits on my blog, I need to post more key-words. So I'll try it.

Ahem, Fall-out Boy. System of the Down. War of the Worlds. George W. Bush. Muhammed Ali. MIAI Abrams. Madison Square Garden. Ferrari. Groundhog Day. Ben Affleck. Stratacaster. McDonalds. Cigar Boats. Mechwarrior 2. Dell. Sasha Cohen. Sleeper Cell. Atom Bomb (yikes). Nascar. WWF. WWII. WWW. WWE. Perry's Ice Cream. Kermit the Frog. Cheeseburger. The Depesche Mode. I don't know if that's even spelled right.

That should do it!

Sunday, July 30, 2006

lost quarters

anewpostisinthemaking! Just letting everyone know that I am still alive. new posts upon this blog will fewen out from now on because I am lo nonger within easy ax-ess of a comp you ter. I do feel bad for all my zillions of devoted fans that are constantly checking my blog to see if I have posted anything that will awe and inspire millions of people worldwide. Very sorry.

Friday, July 14, 2006

groovy post

I made another new blog awhile ago. It is specifically designed for smarty pantses. Just click on the "Go Here" link on my sidebar.

Wednesday, July 12, 2006

Distressing News

I have most distressing news for everyone to hear; I have died.

Actually, I will be moving out of my lovely abode to live with my evil, wicked, dastardly, sinister, heartless, cruel, brother Dave. Here is the distressing part though; his new rented house is right next door to the Millimans house!! dun-dun-dunnn! Poor Millimans. How will they ever be able to handle me living next door to them? After all, I am a very obnoxious, noisy, pesky, stupid, emarassing-to-be-around, kid.

Hi Shelly!

Wednesday, July 05, 2006

My-Space

Ever notice how, when you browse through random blogs that 75% of them come to an abrupt end in 2004? Is this a result of My-space?

I have looked at some my-space pages and really can't figure out what makes my-space so much more coolerer than everything else.

Thoughts?

Wednesday, June 28, 2006

username

How much trouble did any of you have when picking a usename for your blog? Monday, I went and made a new blog for myself seperate from all the other blogs just so I could be somebody else. I entered in my first username wich was goodguy, then entered in my password and a fake e-mail address. Then I found out that the username was unavailable so I entered in another, wilder username. after going through the whole process of making a new blog and even posting one thing, I signed out and then went to work. At work I realiZed that I could no longer remember my username and I just spent 45 minutes this morning trying to remember it! But unfortunatel I could not remember it and I can't even delete the blog now!