My bloggie is now 50 posts old!!! I think I deserve some kind of medal for that. Or at least a promotion to... Semi-Cool Blogger status. My mom is a General in the blogger army. She's got like, 50,000,000,000 posts.
Yeah, so... now we need to throw a party and break open the keg (only kidding, I've never even seen a real keg) and General Mom can promote me in a very ceremonious ceremony. YAY!
Thursday, February 01, 2007
Monday, January 22, 2007
bowSnoarding
On saturday I went snowboarding at Bristol Mountain. it was fun. Brian went too. We went on the hill and I fell down a lot. I went snowboarding only once before.
Josiah Teal -5 1/2 yrs.
Yeah. That sounds pretty good. So I'm really not very good at snowboarding yet and I did fall a lot. I have lots of aches and pains right now that keep reminding me of that. I need to go again so I can get more skilled but it isn't the cheapest hobby in the world, unfortunately.
Yeah so... that's another post.
P.S. I knocked a little kid down.
Josiah Teal -5 1/2 yrs.
Yeah. That sounds pretty good. So I'm really not very good at snowboarding yet and I did fall a lot. I have lots of aches and pains right now that keep reminding me of that. I need to go again so I can get more skilled but it isn't the cheapest hobby in the world, unfortunately.
Yeah so... that's another post.
P.S. I knocked a little kid down.
Thursday, January 18, 2007
Urgent Mission pt.1
Yeah so... this is a new post.
Recently, my friend from the CIA called and told me that he worked for the CIA and that he needed me to go to Clifford Ave. in Rochester because he had reason to believe that there was some kind of sinister plot unfolding that could put the whole world in danger. Unfortunately for him somebody overheard him tell me that he worked for the CIA and he was promptly taken to a maximum security prison in the Mojave desert. Now evidently, my friend somehow knew that I did recon and sting operations for the Delta Force when I was just a lad, and that was semi-creepy. Anywho, I went to the location he had disclosed to me (why he chose Clifford Ave. I'll never know) and located a fellow who was waiting for me. He showed me to a secret lair, underground where I was absolutely astonished to find my brother Jim typing on a computer. Now, as it turns out, my brother was evidently part of a secret organization known as the BPF or the Bad People Finders, and they had a job for me.
YAHOO!
Recently, my friend from the CIA called and told me that he worked for the CIA and that he needed me to go to Clifford Ave. in Rochester because he had reason to believe that there was some kind of sinister plot unfolding that could put the whole world in danger. Unfortunately for him somebody overheard him tell me that he worked for the CIA and he was promptly taken to a maximum security prison in the Mojave desert. Now evidently, my friend somehow knew that I did recon and sting operations for the Delta Force when I was just a lad, and that was semi-creepy. Anywho, I went to the location he had disclosed to me (why he chose Clifford Ave. I'll never know) and located a fellow who was waiting for me. He showed me to a secret lair, underground where I was absolutely astonished to find my brother Jim typing on a computer. Now, as it turns out, my brother was evidently part of a secret organization known as the BPF or the Bad People Finders, and they had a job for me.
YAHOO!
Sunday, December 31, 2006
Poaching Redifined
On thursday, Dec. 28, Jim showed me a short movie clip from Nat. Geographic about poachers and poacher patrol and found out some startling information about the Poacher Patrol.
The clip shows the group of poacher patrollers (goodguys, right?) in South America, as they look for signs of poachers that cut down the trees. The Patrol does not want the trees to be cut down because the rain will begin to wash away the soil in the places where the trees have been taken. Eventually they hear the sound of a distant chainsaw and begin to creep up on the wicked people who cut down poor defenseless trees. Moving when the chainsaw is running (or so they think) in order to cover the sound of thier approach, the patrol finally falls upon a group of local farmers and promptly slaps hand cuffs on every one of them. One officer then hands one of them a GPS Navigator and explains to him that it is a lie detector (a lie, ironically). The farming tree poacher then has to answer the officers questions regarding the location of his rebel lumber yard and such. The heroic poacher patrollers also find out that the farmers are using the wood to build some much needed..., I think it had something to do with the storage of crops or something that the farmers really needed.
Once at the secret lumber yard, wich is filled with beautiful South American lumber, the heroic patrollers proceed to torch every square inch of lumber that they can find in the name of preserving the environment.
Does this make any sense at all?? That leaves another spot of barren land to get washed away by the rain, it also makes it so that the farmers (not poachers, that's just dumb) have to cut down more trees somewhere else and, these biologists (that's what some of these patrollers were) aren't doing much to curb "global warming" now, are they? I think they were just being jerks.
It makes me think differently about poachers. Poor, helpless poachers.
The clip shows the group of poacher patrollers (goodguys, right?) in South America, as they look for signs of poachers that cut down the trees. The Patrol does not want the trees to be cut down because the rain will begin to wash away the soil in the places where the trees have been taken. Eventually they hear the sound of a distant chainsaw and begin to creep up on the wicked people who cut down poor defenseless trees. Moving when the chainsaw is running (or so they think) in order to cover the sound of thier approach, the patrol finally falls upon a group of local farmers and promptly slaps hand cuffs on every one of them. One officer then hands one of them a GPS Navigator and explains to him that it is a lie detector (a lie, ironically). The farming tree poacher then has to answer the officers questions regarding the location of his rebel lumber yard and such. The heroic poacher patrollers also find out that the farmers are using the wood to build some much needed..., I think it had something to do with the storage of crops or something that the farmers really needed.
Once at the secret lumber yard, wich is filled with beautiful South American lumber, the heroic patrollers proceed to torch every square inch of lumber that they can find in the name of preserving the environment.
Does this make any sense at all?? That leaves another spot of barren land to get washed away by the rain, it also makes it so that the farmers (not poachers, that's just dumb) have to cut down more trees somewhere else and, these biologists (that's what some of these patrollers were) aren't doing much to curb "global warming" now, are they? I think they were just being jerks.
It makes me think differently about poachers. Poor, helpless poachers.
Monday, December 18, 2006
High Speed Chase on 104
On Friday Dec. 15, 2006, at approximately 4:15 pm. I was at work cooking haddock when a NYS Police Trooper pulled in the parking lot. Of course this wasn't very unusual by itself, however, Mr Trooper stepped out of his patrol car and began talking with a man in a white sedan, which was slightly more unusaul. Soon I was distracted from being distracted by the police officer, and began to focus on cooking food (a good thing I suppose). About 1 minute later Brianna came rushing in from the dining room screaming something about a car hitting a tree. I looked up and saw that the white sedan and the police car wre gone and in place of them were tire tracks leading from the parking lot and into the lawn and over a small tree. The tracks continued over the lawn and then disappeared onto 104. I knew then that there was a high speed chase underway that would most likely end in an accident. About every three minutes a police vehicle would go flying by the restaurant eastward after the vehicle. I later learned that the chase had ended about 2-3 miles from orbakers right near Reed Eye Center in sodus. From what I could gather the white car had sideswiped a couple other vehicles before flying over the edge of the road and over some nasty bumps. Joel informed me today that he learned from the Wayne County Times that the car had been stolen in webster. I still haven't been able to find any articles about it on the internet site.
THE END
THE END
Tuesday, December 05, 2006
ranting
Okay, I really don't have anything to say. I am only doing this so that my blog won't die. Please don't die blog, don't die on me, I love you! Stay with me blog come on, stay awake. No, don't go to sleep, that could be bad. You might never wake up.
This is what I mean by ranting.
Well, it looks as if the librarians are turning all the computers off. Time to go. |
Saturday, November 18, 2006
Any good ideas?
Hello everyone! This is a new post, isn't it exciting? I canever think of anything cool to write about. I need some inspiration. Or do you just write about how you stub your toe or bite your tongue?
Okay, so yesterday I made $37.50 in tips for delivering pizzas! Isn't that great? Oh yeah, I am getting pretty tired of my jobs. I want to do something else now. Any good ideas?
Okay, so yesterday I made $37.50 in tips for delivering pizzas! Isn't that great? Oh yeah, I am getting pretty tired of my jobs. I want to do something else now. Any good ideas?
Thursday, November 09, 2006
no thing
Nothing truly postworthy has happened to me in the past few days. Nothing that I can think of anyway.
By the way, those letters in the title of that other post were all command keys (I think that's what they are called).
By the way, those letters in the title of that other post were all command keys (I think that's what they are called).
Thursday, October 19, 2006
yuiopasfzxcvbn
ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da ah-da ah-da-da-poo-bu-da
ah-da-poo-bu-da!
I did that because I forgot what to write about.
Today at work, I got yelled at for someone elses laziness in front of everyone. I hate it when that happens.
Trivia: What do all the letters in the title have in common (aside from them all being lowercase)?
ah-da-poo-bu-da!
I did that because I forgot what to write about.
Today at work, I got yelled at for someone elses laziness in front of everyone. I hate it when that happens.
Trivia: What do all the letters in the title have in common (aside from them all being lowercase)?
Wednesday, October 11, 2006
Parts Search
My Chevy S10 LS 4x2 Pickup truck is evidently a pretty hard truck to buy parts for. All I needed for it was a bumper bar with the impact stip, and a slotted or barred grille. So far I have been to Ontario Truck Parts, the Cobbs lot in Sodus, Wilberts GM Parts in Penfield, Andy's Auto Parts in Union Hill, and the Door Store in Ontario and none of them have what I need!
Item 1, 1998 Chevy S10 LS 2WD Pickup chrome front bumper with impact strip. ($200.oo new) Item 2, 1998 Chevy S10 LS 2WD Pickup slotted/barred grille. ($125.oo new)
I almost feel as if I'm trying to get parts for a Ferarri or something.
My last stop was the Door Store and they gave me the most hope of finally getting what I need by offering to order the parts used. $140.oo for the front bumper assembly and $88.oo for the grille. I believe I will take that offer.
I do feel pretty privileged about owning such a unique piece of machinery. The LS is the second most desireable S10 pickup with the S10 extreme coming in first. My truck also has the extremely rare and super-stylish limited edition black rims. haha.
sometimes I have trouble organizing my paragraphs.
Item 1, 1998 Chevy S10 LS 2WD Pickup chrome front bumper with impact strip. ($200.oo new) Item 2, 1998 Chevy S10 LS 2WD Pickup slotted/barred grille. ($125.oo new)
I almost feel as if I'm trying to get parts for a Ferarri or something.
My last stop was the Door Store and they gave me the most hope of finally getting what I need by offering to order the parts used. $140.oo for the front bumper assembly and $88.oo for the grille. I believe I will take that offer.
I do feel pretty privileged about owning such a unique piece of machinery. The LS is the second most desireable S10 pickup with the S10 extreme coming in first. My truck also has the extremely rare and super-stylish limited edition black rims. haha.
sometimes I have trouble organizing my paragraphs.
Monday, October 09, 2006
AAAAAHHHAHAAHAHAAAHAH!!!
I am completely out of blogging ideas. My blog is dying. What shall I do to saveth it?
Joe's high. Says Ben the Bold. I wisheth I knew how to posteth a video.
I beggeth every body to helpeth me to resurecteth my blog, before it's too late.
Joe's high. Says Ben the Bold. I wisheth I knew how to posteth a video.
I beggeth every body to helpeth me to resurecteth my blog, before it's too late.
Thursday, September 21, 2006
A Story
One day, a very geeky, dorky, nerdy kid named Joe delivered a pizza to somebody's humble abode. He knocked on the door and a strange old man answered from somewhere inside. His voice was very raspy and nearly indiscernable but Joe could barely make out the words "Come on in but don't step on the rug, it's been rigged."
What happens next?? You decide. Continue my story.
What happens next?? You decide. Continue my story.
Monday, September 18, 2006
blah
Oh boy, another post.
I am at the library right now and I can't think of anything exciting to say.
I am at the library right now and I can't think of anything exciting to say.
Tuesday, September 12, 2006
SMART!!!!!!!!!!!!!!
Blog blog blog blog blog.
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
cgatctagcatacgacgcatacgcatgcgtgactgcgatatgcgctatactgc
atgacgtatcagacgtgactgctgatgagccgta
gccatagctgcatcgactgcataatccatgatgatcgactgtacagtcagtac
gtacgtactgactagctgtcagactgcgtatgcat
That looks like DNA! (fanfare)
Im gonna grow up to be smart someday. I'll have all the smartness I could ever want and then I will devise an evil scheme to take over all of the world. And then I will use my endless resources to build a giant rocket ship for myself and I'll fly away to some distant planet and begin my own civilization, leaving the rest of humanity to suffer on this rotten planet!!
Now doesn't that sound like the scheme of a supersmart man to execute?
Sunday, August 27, 2006
Sunday, August 20, 2006
Free Post.
NEW POST!!!!!!!!!!!! Free Downloads.Free Viruses. Free spyware. free adware. Free smileys. Free games. (Popcap.com) Free Plasma TV. Free X-Box 360. Free screensavers. Free music on iTunes.com. Free bit-torrents. Free Ferrari F-50 with your purchase of any one of our great tasting soft drinks. Free DVD's. Free PDP's. Free PDVDP's. Free Superpowers, inquire within. Free vacation in the bahamas. Free dinner for two at Appledee's. Free movie tickets. Free police cruiser. Free assault weapons. Free ocean. Free ocean liner. Free dinosaur.
Friday, August 04, 2006
Key Words
Blogging again. Yes, remember that anyone can comment on my blog if they so desire.
My dear brother Jimmy said that in order to get more hits on my blog, I need to post more key-words. So I'll try it.
Ahem, Fall-out Boy. System of the Down. War of the Worlds. George W. Bush. Muhammed Ali. MIAI Abrams. Madison Square Garden. Ferrari. Groundhog Day. Ben Affleck. Stratacaster. McDonalds. Cigar Boats. Mechwarrior 2. Dell. Sasha Cohen. Sleeper Cell. Atom Bomb (yikes). Nascar. WWF. WWII. WWW. WWE. Perry's Ice Cream. Kermit the Frog. Cheeseburger. The Depesche Mode. I don't know if that's even spelled right.
That should do it!
My dear brother Jimmy said that in order to get more hits on my blog, I need to post more key-words. So I'll try it.
Ahem, Fall-out Boy. System of the Down. War of the Worlds. George W. Bush. Muhammed Ali. MIAI Abrams. Madison Square Garden. Ferrari. Groundhog Day. Ben Affleck. Stratacaster. McDonalds. Cigar Boats. Mechwarrior 2. Dell. Sasha Cohen. Sleeper Cell. Atom Bomb (yikes). Nascar. WWF. WWII. WWW. WWE. Perry's Ice Cream. Kermit the Frog. Cheeseburger. The Depesche Mode. I don't know if that's even spelled right.
That should do it!
Sunday, July 30, 2006
lost quarters
anewpostisinthemaking! Just letting everyone know that I am still alive. new posts upon this blog will fewen out from now on because I am lo nonger within easy ax-ess of a comp you ter. I do feel bad for all my zillions of devoted fans that are constantly checking my blog to see if I have posted anything that will awe and inspire millions of people worldwide. Very sorry.
Friday, July 14, 2006
groovy post
I made another new blog awhile ago. It is specifically designed for smarty pantses. Just click on the "Go Here" link on my sidebar.
Subscribe to:
Posts (Atom)